Molecular epidemiology of Impatiens necrotic spot virus on greenhouse ornamental plants in a local area of Japan

2015 ◽  
Vol 81 (6) ◽  
pp. 429-438 ◽  
Author(s):  
Syuuichi Nekoduka ◽  
Kappei Kobayashi ◽  
Shin-ichi Fuji ◽  
Mitsuru Okuda ◽  
Teruo Sano
Keyword(s):  
Molecular Epidemiology ◽  
Ornamental Plants ◽  
Local Area ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus

Impatiens necrotic spot virus. [Distribution map].

2007 ◽  
Author(s):  
Keyword(s):  
New York ◽  
South Carolina ◽  
Frankliniella Occidentalis ◽  
Ornamental Plants ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Distribution Map ◽  
Spot Virus ◽  
Virus Distribution ◽  
Distribution In Europe

Abstract A new distribution map is provided for Impatiens necrotic spot virus. Bunyaviridae: Tospovirus. Hosts: daisy (Chrysanthemum), balsam (Impatiens) and some other ornamental plants. Information is given on the geographical distribution in Europe (Austria, Belgium, Czech Republic, Finland, France (mainland France), Germany, Hungary, Italy (mainland Italy, Sicily), Netherlands, Poland, Portugal, Slovenia, Spain, UK (England and Wales)), Asia (Iran, Israel, Japan (Honshu)), North America (Canada (Alberta, British Columbia, Manitoba, Ontario, Quebec), Mexico, USA (Arkansas, California, Colorado, Connecticut, Delaware, Florida, Georgia, Idaho, Iowa, Kansas, Kentucky, Maine, Maryland, Massachusetts, Minnesota, Mississippi, Missouri, New Hampshire, New Jersey, New York, North Carolina, North Dakota, Ohio, Oklahoma, Oregon, Pennsylvania, South Carolina, Texas, Vermont, Virginia)), Central America and Caribbean (Costa Rica), South America (Chile), Oceania (New Zealand). It is vectored by Frankliniella occidentalis (Thysanoptera: Thripidae).

scholarly journals First Report of Impatiens necrotic spot virus on Begonia in Bosnia and Herzegovina

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 1004-1004 ◽  
Author(s):  
V. Trkulja ◽  
J. Mihić Salapura ◽  
B. Ćurković ◽  
I. Stanković ◽  
A. Bulajić ◽  
...  
Keyword(s):  
Bosnia And Herzegovina ◽  
Ornamental Plants ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Negative Controls

Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) are the most serious viral pathogens in the production of ornamental plants in Europe and North America (1). During a survey for the presence of tospoviruses in July 2012, potted begonia hybrids (Begonia × tuberhybrida Voss) exhibiting foliar chlorotic rings and zonal spots accompanied by leaf necrosis and distortion, were observed in a greenhouse in the vicinity of Banja Luka (Bosnia and Herzegovina). Leaf samples collected from 12 symptomatic plants were analyzed for the presence of INSV and TSWV by commercial double-antibody sandwich (DAS)-ELISA kits (Bioreba AG, Reinach, Switzerland). Commercial positive and negative controls and extracts from healthy begonia leaves were included in each ELISA. INSV was detected serologically in all 12 begonia samples and all tested samples were negative for TSWV. Five healthy plants of each Petunia × hybrida and Nicotiana benthamiana were mechanically inoculated with sap from an ELISA-positive sample (157-12) using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulphite. Local necrotic lesions on P. × hybrida and systemic chlorotic mottling on N. benthamiana were observed on all inoculated plants 4 and 10 days post-inoculation, respectively. For further confirmation of INSV infection, total RNAs were extracted from all ELISA-positive begonia plants as well as mechanically inoculated N. benthamiana plants with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used as template in reverse transcription (RT)-PCR. RT-PCR was performed with the OneStep RT-PCR Kit (Qiagen) using primer pair INSV-589 and TOS-R15 (3), specific to the partial INSV nucleocapsid (N) gene. Total RNA obtained from Serbian INSV isolate from a begonia (GenBank Accession No. HQ724289) and RNA extracts from healthy begonia plants were used as positive and negative controls, respectively. All naturally and mechanically infected plants as well as the positive control yielded an amplicon of the expected size (589 bp), while no amplification products were obtained from the healthy controls. The RT-PCR product derived from the isolate 157-12 was sequenced directly after purification with QIAquick PCR Purification Kit (Qiagen) and submitted to GenBank (KC494869). Pairwise comparison of the 157-12 isolate N sequence with other homologous sequences available in GenBank, conducted using MEGA5 software (2), revealed that begonia isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with the Chinese INSV isolate (FN400772) originating from Oncidium sp. To our knowledge, this is the first report of INSV on begonia in Bosnia and Herzegovina. Begonias are very popular and widely grown ornamentals in Bosnia and Herzegovina and the presence of a new and devastating pathogen could represent a serious threat for its production. Since begonia is commonly grown together with numerous ornamental plants susceptible to INSV, further investigations are needed in order to prevent spread of this potentially harmful pathogen to new hosts in Bosnia and Herzegovina. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (3) H. Uga and S. Tsuda. Phytopathology 95:166, 2005.

scholarly journals Occurrence of Impatiens necrotic spot virus in Ornamentals in Mahallat and Tehran Provinces in Iran

Plant Disease ◽  
2002 ◽  
Vol 86 (6) ◽  
pp. 694-694 ◽  
Author(s):  
N. Shahraeen ◽  
T. Ghotbi ◽  
A. H. Mehraban
Keyword(s):  
Ornamental Plants ◽  
Dianthus Caryophyllus ◽  
Positive Control ◽  
Thrips Tabaci ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Chenopodium Amaranticolor ◽  
Severity Of The Disease

Impatiens necrotic spot virus (INSV) (genus Tospovirus, family Bunyaviridae) has been detected in commercial nurseries and field-grown ornamentals in Mahallat (Markazi) and Tehran provinces of Iran. INSV on ornamentals was first reported in 1990 (2). Ornamental plants with small necrotic spots, leaf yellowing, ring spots, necrotic vein clearing, wilting, and dwarf symptoms were collected. For mechanical inoculation on selected host species, leaf samples were triturated in chilled 0.01 phosphate buffer, pH 7.2, containing 0.02% sodium sulfite. Cowpea (cv. Mashad local), Chenopodium amaranticolor, Datura mete, Nicotiana rustica, N. tabacum (cv. White Burly), and Lycopersicon sp. produced local necrotic symptoms 5 days postinoculation. N. rustica, N. tabacum cv. White Burley, and D. metel also developed systemic mosaic symptoms that were followed by total wilting and death of the plant. The severity of the disease was higher in warm weather (July and August in greenhouses). Thrips tabaci and Frankliniella intonsa were often present at the site of INSV infection. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) was applied using a commerical polyclonal antibody kit (As-0115) in combination with monoclonal antibody 5E4 (As-0117) prepared against nucleoprotein of INSV isolate Pv-0280 (antibody kits and positive control were a gift from DSMZ, Braunschweig, Germany). Samples were tested for the presence of TSWV and INSV. The ornamental species found infected with INSV were Rosa sp., Gazania sp., Chrysanthemum sp., Leucanthemum sp., Matricaria camomila, Pelargonium roseum, Salvia sp., and Dianthus caryophyllus, which were collected from the Mahallat area; and Gazania sp. and Bougainvillea spectabilis collected from the Tehran Province. ELISA values of field-infected samples (OD405, read after 1h) diluted at 1:10 (wt/vol) were 0.317 (minimum) and 0.914 (maximum), and 0.312 for the positive control. None of the samples reacted in TAS-ELISA with Tomato spotted wilt virus (TSWV) (antibody kits, As-0105, As-0106, and As-01106, gift from DSMZ). A few samples of Chrysanthemum sp. and Leucanthemum sp. (collected from the Mahallat area) reacted in TAS-ELISA with TSWV, indicating they were doubly infected with TSWV and INSV. Within the genus Tospovirus the TSWV peanut isolate has been reported from Iran (1). To our knowledge, this is the first report of the occurrence of INSV on ornamentals in Iran. References: (1) A. R. Golnaraghi et al. Plant Dis. 85:1286, 2001 (2) M. D. Law and J. W. Moyer. J. Gen.Virol.71:933, 1990.

scholarly journals Detection of a Severe Isolate of Impatiens Necrotic Spot Virus Infecting Lisianthus in Florida

Plant Disease ◽  
1997 ◽  
Vol 81 (11) ◽  
pp. 1334-1334 ◽  
Author(s):  
R. J. McGovern ◽  
J. E. Polston ◽  
B. K. Harbaugh
Keyword(s):  
Leaf Tissue ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Eustoma Grandiflorum ◽  
Systemic Necrosis ◽  
Low Incidence ◽  
Leaf Distortion

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (<0.1%) in greenhouse-grown lisianthus in Manatee County, FL. Symptomatic tissue tested positive for impatiens necrotic spot virus (INSV) and negative for tomato spotted wilt virus (TSWV) with enzyme-linked immunosorbent assay (ELISA; Agdia, Elkhart, IN). Mechanical transmission of the virus to lisianthus and tomato was attempted by triturating 1 g of symptomatic leaf tissue in 7 ml of a buffer consisting of 0.01 M Tris and 0.01 M sodium sulfite, pH 7.3. Six plants of lisianthus cv. Maurine Blue and three of tomato (Lycopersicon esculentum) cv. Lanai at the second true-leaf stage were inoculated following abrasion of leaves with Carborundum. An equal number of controls were inoculated with buffer alone. Plants were maintained in a controlled environment chamber with a 12-h photoperiod, day/night temperatures of 21/16°C, and light intensity of 120 μE · s-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

scholarly journals First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽  
2004 ◽  
Vol 88 (7) ◽  
pp. 771-771 ◽  
Author(s):  
N. Martínez-Ochoa ◽  
S. W. Mullis ◽  
A. S. Csinos ◽  
T. M. Webster
Keyword(s):  
Southeastern United States ◽  
Impatiens Necrotic Spot Virus ◽  
Cyperus Esculentus ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Black Shank ◽  
Purple Nutsedge ◽  
Yellow Nutsedge ◽  
Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
J. M. Crosslin ◽  
L. L. Hamlin
Keyword(s):  
Frankliniella Occidentalis ◽  
Solanum Tuberosum L ◽  
Consensus Sequence ◽  
Western Flower Thrips ◽  
Alternaria Solani ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Feeding Damage ◽  
Rt Pcr ◽  
Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

SERIOUS DAMAGES BY IMPATIENS NECROTIC SPOT VIRUS IN ZANTEDESCHIA AETHIOPICA

2013 ◽  
pp. 319-325 ◽  
Author(s):  
S. Lazzereschi ◽  
B. Nesi ◽  
S. Pecchioli ◽  
A. Grassotti ◽  
D. Rizzo ◽  
...  
Keyword(s):  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Zantedeschia Aethiopica

scholarly journals First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1248-1248 ◽  
Author(s):  
S. T. Koike ◽  
Y.-W. Kuo ◽  
M. R. Rojas ◽  
R. L. Gilbertson
Keyword(s):  
Frankliniella Occidentalis ◽  
Disease Incidence ◽  
Pcr Analysis ◽  
Impatiens Necrotic Spot Virus ◽  
Vegetable Crops ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Monterey County

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

Sign in / Sign up

Export Citation Format

Share Document