scholarly journals Detection of a Severe Isolate of Impatiens Necrotic Spot Virus Infecting Lisianthus in Florida

Plant Disease ◽  
1997 ◽  
Vol 81 (11) ◽  
pp. 1334-1334 ◽  
Author(s):  
R. J. McGovern ◽  
J. E. Polston ◽  
B. K. Harbaugh
Keyword(s):  
Leaf Tissue ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Eustoma Grandiflorum ◽  
Systemic Necrosis ◽  
Low Incidence ◽  
Leaf Distortion

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (<0.1%) in greenhouse-grown lisianthus in Manatee County, FL. Symptomatic tissue tested positive for impatiens necrotic spot virus (INSV) and negative for tomato spotted wilt virus (TSWV) with enzyme-linked immunosorbent assay (ELISA; Agdia, Elkhart, IN). Mechanical transmission of the virus to lisianthus and tomato was attempted by triturating 1 g of symptomatic leaf tissue in 7 ml of a buffer consisting of 0.01 M Tris and 0.01 M sodium sulfite, pH 7.3. Six plants of lisianthus cv. Maurine Blue and three of tomato (Lycopersicon esculentum) cv. Lanai at the second true-leaf stage were inoculated following abrasion of leaves with Carborundum. An equal number of controls were inoculated with buffer alone. Plants were maintained in a controlled environment chamber with a 12-h photoperiod, day/night temperatures of 21/16°C, and light intensity of 120 μE · s-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

scholarly journals Spathiphyllum sp.: A New Natural Host of Impatiens necrotic spot virus

Plant Disease ◽  
2001 ◽  
Vol 85 (4) ◽  
pp. 448-448 ◽  
Author(s):  
A. Materazzi ◽  
E. Triolo
Keyword(s):  
Mosaic Virus ◽  
Alfalfa Mosaic Virus ◽  
Systemic Infection ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Spot Virus ◽  
New Host ◽  
Arabis Mosaic Virus ◽  
Wilt Virus

In September 1999, several Spathiphyllum plants grown in a greenhouse in Tuscany (Italy) showed leaf symptoms in the form of concentric chlorotic ringspots, line patterns, and irregular chlorotic blotches. These symptoms developed into localized necrosis. Crude sap of tissues showing symptoms was mechanically inoculated to young symptomless Spathiphyllum plants and to Nicotiana benthamiana and N. clevelandii. Samples drawn from symptomatic and symptomless tissues of naturally or artificially infected Spathiphyllum and Nicotiana plants were tested for the presence of Alfalfa mosaic virus (AMV), Arabis mosaic virus (ArMV), Cucumber mosaic virus (CMV), Dasheen mosaic virus (DsMV), Impatiens necrotic spot virus (INSV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), and Tomato spotted wilt virus (TSWV) by double-antibody sandwich enzyme-linked immunosorbent assay carried out with commercial antisera. The symptomatic tissues obtained from Spathiphyllum and Nicotiana plants gave a positive reaction only for INSV. The symptomless samples obtained from various parts of the infected Spathiphyllum plants gave a negative reaction, even after 1 year from the appearance of localized necrosis, suggesting a non-systemic infection in this new host. This is the first report of infection of Spathiphyllum sp. by INSV.

scholarly journals First Report of Impatiens necrotic spot virus in Ornamental Plants in Hungary

Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 331-331 ◽  
Author(s):  
E. K. Tóth ◽  
É. Kriston ◽  
A. Takács ◽  
M. Bajtek ◽  
G. Kazinczi ◽  
...  
Keyword(s):  
Frankliniella Occidentalis ◽  
Sandwich Elisa ◽  
Ornamental Plant ◽  
Thrips Tabaci ◽  
Plant Production ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Eustoma Grandiflorum ◽  
Thrips Species

Economically important viruses such as Tomato spotted wilt virus, genus Tospovirus, are transmissible mechanically and mainly by two thrips species (Thrips tabaci and Frankliniella occidentalis) in Hungary (1). Samples (31) of eight ornamental plant species (Catharanthus roseus, Cyclamen persicum, Dendranthema × grandiflorum, Eustoma grandiflorum, Gerbera sp., Impatiens walleriana, Ocimum basilicum, and Verbena hybrida) were studied. Symptoms including color breaking on flowers and necrotic symptoms on leaves were observed on four samples (C. persicum, I. walleriana, O. basilicum, and E. grandiflorum). Infection by Impatiens necrotic spot virus (INSV) was determined by double-antibody sandwich-ELISA and triple-antibody sandwich-ELISA using antisera obtained from Loewe (Sauerlach, Germany) and the DSMZ. Back inoculation with the F. occidentalis vector was also carried out to Lycopersicon esculentum as indicator plants. Back inoculation was also positive for INSV by symptoms and ELISA. The high amount of ornamental plant production together with the use of virus-infected propagation material and the increasing thrips vector populations may result in significantly increased establishment and distribution of INSV in Hungary. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

Field Survey of Impatiens Necrotic Spot Virus in Georgia Peanut

2001 ◽  
Vol 28 (1) ◽  
pp. 34-37 ◽  
Author(s):  
M. L. Wells ◽  
H. R. Pappu ◽  
A. K. Culbreath ◽  
J. W. Todd ◽  
S. L. Brown
Keyword(s):  
Field Survey ◽  
Production Systems ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Growing Seasons ◽  
Arachis Hypogaea L ◽  
Peanut Production ◽  
Natural Incidence

Abstract A field survey to determine the incidence of Impatiens necrotic spot virus (INSV) in Georgia peanut (Arachis hypogaea L.) was conducted during the 1999 and 2000 growing seasons. Confirmation of INSV infection was made by enzyme-linked immunosorbent assay (ELISA). During August 1999, a total of 504 symptomatic peanut plants were sampled from 42 fields representing 15 counties. Peanut plants showing symptoms of spotted wilt from 14, 15, and 15 counties were sampled during the early (June), mid (July), and late (August/September) periods of the 2000 growing season, respectively. During 2000, a total of 1433 peanut plants were sampled over the course of the survey. The 1999 survey yielded no INSV-positive peanut plants, while 87% of the plants sampled tested positive for TSWV. During the 2000 survey, INSV was detected from 2.0% of all peanut plants sampled, while TSWV was detected in 97.8% of all plants. All plants that tested positive for INSV also tested positive for TSWV. TSWV was detected from plants in each field. INSV was only detected from seven fields in four counties. Additionally, 90 peanut plants were tested for INSV in a Coffee County field in which that virus was detected in July 2000. TSWV was detected in 94% of those plants, while INSV was detected in 20% of the plants. Double infections were detected in 17% of the plants from the field in Coffee County. The natural incidence of another Tospovirus in peanut could have important management implications for peanut production systems.

scholarly journals Spinach (Spinacia oleracea) is a New Natural Host of Impatiens necrotic spot virus in California

Plant Disease ◽  
2009 ◽  
Vol 93 (6) ◽  
pp. 673-673 ◽  
Author(s):  
H.-Y. Liu ◽  
J. L. Sears ◽  
B. Mou
Keyword(s):  
Mosaic Virus ◽  
Spinacia Oleracea ◽  
The United States ◽  
Natural Host ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Mechanical Transmission ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus

Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-GGATGTAAGCCCTTCTTTGTAGTGG-3′) and reverse (5′-CCTTCCAAGTCACCCTCTGATTG-3′) primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1–4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.

scholarly journals First Report of Impatiens necrotic spot virus in the Czech Republic

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1045-1045 ◽  
Author(s):  
J. Mertelik ◽  
V. Mokra ◽  
B. Gotzova ◽  
S. Gabrielova
Keyword(s):  
Czech Republic ◽  
Plant Species ◽  
Frankliniella Occidentalis ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Weed Species ◽  
Stellaria Media ◽  
Spot Virus ◽  
The Czech Republic

Impatiens necrotic spot virus (INSV) was found for the first time in the Czech Republic in 1999 in Columnea sp. and Curcuma sp. plants that were imported. They were grown in a garden among other ornamental crops. By June 2000, INSV was detected in 17 ornamental plant species in several gardening establishments never having received imported plants. Frankliniella occidentalis thrips were present at the sites of INSV infection. Natural INSV infection was found also in Stellaria media, which is an important weed species in our conditions. INSV was identified by enzyme-linked immunosorbent assay using polyclonal antibodies to INSV from Loewe Biochemica, Germany, and from Bioreba, Switzerland. The virus was transmitted in sap to Nicotiana benthamiana and Datura stramonium (1). Virus particles typical of a tospovirus were detected by electron microscopy. INSV is the second tospovirus member occurring in the Czech Republic. Tomato spotted wilt virus (TSWV) has occurred in this country since 1992 (2) and to date has been detected in more than 100 plant species including ornamentals, vegetables, and weeds. TSWV became a serious problem in glasshouse grown crops. From the epidemiological point of view the situation of INSV dissemination seems to be similar to that of TSWV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) J. Mertelik and V. Mokra. Acta Virol. 42:348, 1998.

scholarly journals Occurrence of Impatiens necrotic spot virus in Ornamentals in Mahallat and Tehran Provinces in Iran

Plant Disease ◽  
2002 ◽  
Vol 86 (6) ◽  
pp. 694-694 ◽  
Author(s):  
N. Shahraeen ◽  
T. Ghotbi ◽  
A. H. Mehraban
Keyword(s):  
Ornamental Plants ◽  
Dianthus Caryophyllus ◽  
Positive Control ◽  
Thrips Tabaci ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Chenopodium Amaranticolor ◽  
Severity Of The Disease

Impatiens necrotic spot virus (INSV) (genus Tospovirus, family Bunyaviridae) has been detected in commercial nurseries and field-grown ornamentals in Mahallat (Markazi) and Tehran provinces of Iran. INSV on ornamentals was first reported in 1990 (2). Ornamental plants with small necrotic spots, leaf yellowing, ring spots, necrotic vein clearing, wilting, and dwarf symptoms were collected. For mechanical inoculation on selected host species, leaf samples were triturated in chilled 0.01 phosphate buffer, pH 7.2, containing 0.02% sodium sulfite. Cowpea (cv. Mashad local), Chenopodium amaranticolor, Datura mete, Nicotiana rustica, N. tabacum (cv. White Burly), and Lycopersicon sp. produced local necrotic symptoms 5 days postinoculation. N. rustica, N. tabacum cv. White Burley, and D. metel also developed systemic mosaic symptoms that were followed by total wilting and death of the plant. The severity of the disease was higher in warm weather (July and August in greenhouses). Thrips tabaci and Frankliniella intonsa were often present at the site of INSV infection. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) was applied using a commerical polyclonal antibody kit (As-0115) in combination with monoclonal antibody 5E4 (As-0117) prepared against nucleoprotein of INSV isolate Pv-0280 (antibody kits and positive control were a gift from DSMZ, Braunschweig, Germany). Samples were tested for the presence of TSWV and INSV. The ornamental species found infected with INSV were Rosa sp., Gazania sp., Chrysanthemum sp., Leucanthemum sp., Matricaria camomila, Pelargonium roseum, Salvia sp., and Dianthus caryophyllus, which were collected from the Mahallat area; and Gazania sp. and Bougainvillea spectabilis collected from the Tehran Province. ELISA values of field-infected samples (OD405, read after 1h) diluted at 1:10 (wt/vol) were 0.317 (minimum) and 0.914 (maximum), and 0.312 for the positive control. None of the samples reacted in TAS-ELISA with Tomato spotted wilt virus (TSWV) (antibody kits, As-0105, As-0106, and As-01106, gift from DSMZ). A few samples of Chrysanthemum sp. and Leucanthemum sp. (collected from the Mahallat area) reacted in TAS-ELISA with TSWV, indicating they were doubly infected with TSWV and INSV. Within the genus Tospovirus the TSWV peanut isolate has been reported from Iran (1). To our knowledge, this is the first report of the occurrence of INSV on ornamentals in Iran. References: (1) A. R. Golnaraghi et al. Plant Dis. 85:1286, 2001 (2) M. D. Law and J. W. Moyer. J. Gen.Virol.71:933, 1990.

scholarly journals First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽  
2004 ◽  
Vol 88 (7) ◽  
pp. 771-771 ◽  
Author(s):  
N. Martínez-Ochoa ◽  
S. W. Mullis ◽  
A. S. Csinos ◽  
T. M. Webster
Keyword(s):  
Southeastern United States ◽  
Impatiens Necrotic Spot Virus ◽  
Cyperus Esculentus ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Black Shank ◽  
Purple Nutsedge ◽  
Yellow Nutsedge ◽  
Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
J. M. Crosslin ◽  
L. L. Hamlin
Keyword(s):  
Frankliniella Occidentalis ◽  
Solanum Tuberosum L ◽  
Consensus Sequence ◽  
Western Flower Thrips ◽  
Alternaria Solani ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Feeding Damage ◽  
Rt Pcr ◽  
Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

SERIOUS DAMAGES BY IMPATIENS NECROTIC SPOT VIRUS IN ZANTEDESCHIA AETHIOPICA

2013 ◽  
pp. 319-325 ◽  
Author(s):  
S. Lazzereschi ◽  
B. Nesi ◽  
S. Pecchioli ◽  
A. Grassotti ◽  
D. Rizzo ◽  
...  
Keyword(s):  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Zantedeschia Aethiopica
Sign in / Sign up

Export Citation Format

Share Document