Effects of multiple doses of ionizing radiation on cytokine expression in rat and human cells

2003 ◽  
Vol 79 (11) ◽  
pp. 889-896 ◽  
Author(s):  
M. Boerma ◽  
C. I. Schutte‐Bart ◽  
L. E. Wedekind ◽  
H. Beekhuizen ◽  
J. Wondergem
Keyword(s):  
Ionizing Radiation ◽  
Cytokine Expression ◽  
Human Cells ◽  
Multiple Doses

DNA-binding protein activated by gamma radiation in human cells

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

scholarly journals DNA-binding protein activated by gamma radiation in human cells.

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin
Keyword(s):  
Dna Binding ◽  
Ionizing Radiation ◽  
Mammalian Cells ◽  
Binding Protein ◽  
Simian Virus 40 ◽  
Dna Binding Protein ◽  
Simian Virus ◽  
Human Cells ◽  
Binding Motif ◽  
Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Ionizing radiation-induced instant pairing of heterochromatin of homologous chromosomes in human cells

2004 ◽  
Vol 104 (1-4) ◽  
pp. 193-199 ◽  
Author(s):  
H.I. Abdel-Halim ◽  
S.A. Imam ◽  
F.M. Badr ◽  
A.T. Natarajan ◽  
L.H.F. Mullenders ◽  
...  
Keyword(s):  
Ionizing Radiation ◽  
Human Cells ◽  
Homologous Chromosomes ◽  
Radiation Induced

scholarly journals NBS1 Knockdown by Small Interfering RNA Increases Ionizing Radiation Mutagenesis and Telomere Association in Human Cells

2005 ◽  
Vol 65 (13) ◽  
pp. 5544-5553 ◽  
Author(s):  
Ying Zhang ◽  
Chang U.K. Lim ◽  
Eli S. Williams ◽  
Junqing Zhou ◽  
Qinming Zhang ◽  
...  
Keyword(s):  
Ionizing Radiation ◽  
Small Interfering Rna ◽  
Human Cells ◽  
Telomere Association ◽  
Interfering Rna

scholarly journals Telomere Shortening Alters the Kinetics of the DNA Damage Response after Ionizing Radiation in Human Cells

2011 ◽  
Vol 4 (12) ◽  
pp. 1973-1981 ◽  
Author(s):  
Rachid Drissi ◽  
Jing Wu ◽  
Yafang Hu ◽  
Carol Bockhold ◽  
Jeffrey S. Dome
Keyword(s):  
Dna Damage ◽  
Ionizing Radiation ◽  
Dna Damage Response ◽  
Human Cells ◽  
Telomere Shortening ◽  
Damage Response ◽  
Kinetics Of

Microarray analysis of the transcriptional responseto single or multiple doses of ionizing radiation in human subcutaneous fibroblasts

2005 ◽  
Vol 77 (3) ◽  
pp. 231-240 ◽  
Author(s):  
Olaug Kristin Rødningen ◽  
Jens Overgaard ◽  
Jan Alsner ◽  
Trevor Hastie ◽  
Anne-Lise Børresen-Dale
Keyword(s):  
Ionizing Radiation ◽  
Microarray Analysis ◽  
Multiple Doses

scholarly journals Engineering Radioprotective Human Cells Using the Tardigrade Damage Suppressor Protein, DSUP

2020 ◽  
Author(s):  
Craig Westover ◽  
Deena Najjar ◽  
Cem Meydan ◽  
Kirill Grigorev ◽  
Mike T. Veling ◽  
...  
Keyword(s):  
Dna Damage ◽  
Ionizing Radiation ◽  
Gene Expression Analysis ◽  
Potential Role ◽  
Hek293 Cell ◽  
Integration Site ◽  
Human Cells ◽  
Systemic Risks ◽  
Damage Response ◽  
Harsh Conditions

AbstractSpaceflight has been documented to produce a number of detrimental effects to physiology and genomic stability, partly a result of Galactic Cosmic Radiation (GCR). In recent years, extensive research into extremotolerant organisms has begun to reveal how they survive harsh conditions, such as ionizing radiation. One such organism is the tardigrade (Ramazzottius varieornatus) which can survive up to 5kGy of ionizing radiation and also survive the vacuum of space. In addition to their extensive network of DNA damage and response mechanisms, the tardigrade also possesses a unique damage suppressor protein (Dsup) that co-localizes with chromatin in both tardigrade and transduced human cells and protects against damage from reactive oxygen species via ionizing radiation. While Dsup has been shown to confer human cells with radioresistance; much of the mechanism of how it does this in the context of human cells remains to be elucidated. In addition, there is no knowledge yet of how introduction of Dsup into human cells can perturb cellular networks and if there are any systemic risks associated. Here, we created a stable HEK293 cell line expressing Dsup via lentiviral transduction and confirmed its presence and its integration site. We show that Dsup confers human cells with a reduction of apoptotic signals. Through measuring these biomarkers of DNA damage in response to irradiation longitudinally along with gene expression analysis, we were able to demonstrate a potential role for Dsup as DNA damage response and repair enhancer much in the same way its human homologous counterpart HMGN1 functions. Our methods and tools provide evidence that the effects of the Dsup protein can be potentially utilized to mitigate such damage during spaceflight.

Sign in / Sign up

Export Citation Format

Share Document