scholarly journals The study of Heat shock protein 70 (Hsp70) gene expression on Ageratum conyzoides L. and Synedrella nodiflora L. in Universitas Indonesia, Depok and Cibodas Botanical Garden

2021 ◽  
Vol 1725 ◽  
pp. 012059
Author(s):  
C K Windarti ◽  
A E Maryanto ◽  
A Salamah ◽  
N Andayani
Keyword(s):  
Gene Expression ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Botanical Garden ◽  
Hsp70 Gene ◽  
Ageratum Conyzoides ◽  
Synedrella Nodiflora

Modulation of Heat-Shock Protein 70 (HSP70) Gene Expression by Sodium Butyrate in U-937 Promonocytic Cells: Relationships with Differentiation and Apoptosis

1997 ◽  
Vol 236 (1) ◽  
pp. 268-274 ◽  
Author(s):  
Laura Garcia-Bermejo ◽  
Nuria E. Vilaboa ◽  
Concepcion Perez ◽  
Alba Galan ◽  
Elena De Blas ◽  
...  
Keyword(s):  
Gene Expression ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Sodium Butyrate ◽  
Heat Shock Protein 70 ◽  
Hsp70 Gene ◽  
Promonocytic Cells

scholarly journals Heat Shock Protein 70 Improves In Vitro Embryo Yield and Quality from Heat Stressed Bovine Oocytes

Animals ◽  
2021 ◽  
Vol 11 (6) ◽  
pp. 1794
Author(s):  
Konstantina Stamperna ◽  
Themistoklis Giannoulis ◽  
Eleni Dovolou ◽  
Maria Kalemkeridou ◽  
Ioannis Nanas ◽  
...  
Keyword(s):  
Gene Expression ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Cumulus Cells ◽  
Intramolecular Interactions ◽  
Developmental Competence ◽  
Embryo Yield ◽  
Bovine Oocytes

Heat shock protein 70 (HSP70) is a chaperon that stabilizes unfolded or partially folded proteins, preventing inappropriate inter- and intramolecular interactions. Here, we examined the developmental competence of in vitro matured oocytes exposed to heat stress with or without HSP70. Bovine oocytes were matured for 24 h at 39 °C without (group C39) or with HSP70 (group H39) and at 41 °C for the first 6 h, followed by 16 h at 39 °C with (group H41) or without HSP70 (group C41). After insemination, zygotes were cultured for 9 days at 39 °C. Cleavage and embryo yield were assessed 48 h post insemination and on days 7, 8, 9, respectively. Gene expression was assessed by RT-PCR in oocytes, cumulus cells and blastocysts. In C41, blastocysts formation rate was lower than in C39 and on day 9 it was lower than in H41. In oocytes, HSP70 enhanced the expression of three HSP genes regardless of incubation temperature. HSP70 at 39 °C led to tight coordination of gene expression in oocytes and blastocysts, but not in cumulus cells. Our results imply that HSP70, by preventing apoptosis, supporting signal transduction, and increasing antioxidant protection of the embryo, protects heat stressed maturing bovine oocyte and restores its developmental competence.

The gene for the heat-shock protein 70 of Euplotes focardii, an Antarctic psychrophilic ciliate

2004 ◽  
Vol 16 (1) ◽  
pp. 23-28 ◽  
Author(s):  
ANTONIETTA LA TERZA ◽  
CRISTINA MICELI ◽  
PIERANGELO LUPORINI
Keyword(s):  
Thermal Stress ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Regulatory Region ◽  
Regulatory Elements ◽  
Specific Response ◽  
Hsp70 Gene ◽  
Sequence Motifs ◽  
Coding Region

In the Antarctic ciliate, Euplotes focardii, the heat-shock protein 70 (Hsp70) gene does not show any appreciable activation by a thermal stress. Yet, it is activated to appreciable transcriptional levels by oxidative and chemical stresses, thus implying that it evolved a mechanism of selective, stress-specific response. A basic step in investigating this mechanism is the determination of the complete nucleotide sequence of the E. focardii Hsp70 gene. This gene contains a coding region specific for an Hsp70 protein that carries unique amino acid substitutions of potential significance for cold adaptation, and a 5' regulatory region that includes sequence motifs denoting two distinct types of stress-inducible promoters, known as “Heat Shock Elements” (HSE) and “Stress Response Elements” (StRE). From the study of the interactions of these regulatory elements with their specific transactivator factors we expect to shed light on the adaptive modifications that prevent the Hsp70 gene of E. focardii from responding to thermal stress while being responsive to other stresses.

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

Sign in / Sign up

Export Citation Format

Share Document