scholarly journals Molecular diversity of Pepper Yellow Leaf Curl Virus (PepYLCV) Infecting Capsicum annuum in West Sumatra

2021 ◽  
Vol 741 (1) ◽  
pp. 012038
Author(s):  
D Cania ◽  
B Nova ◽  
T Runifah ◽  
R Hidayati ◽  
A Anwar ◽  
...  
Keyword(s):  
Capsicum Annuum ◽  
Molecular Diversity ◽  
Yellow Leaf ◽  
West Sumatra ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Seed transmission of Tomato yellow leaf curl virus in sweet pepper (Capsicum annuum)

2017 ◽  
Vol 150 (3) ◽  
pp. 759-764 ◽  
Author(s):  
Eui-Joon Kil ◽  
Jungho Park ◽  
Eun-Young Choi ◽  
Hee-Seong Byun ◽  
Kyeong-Yeoll Lee ◽  
...  
Keyword(s):  
Capsicum Annuum ◽  
Seed Transmission ◽  
Sweet Pepper ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus

2005 ◽  
Vol 95 (9) ◽  
pp. 1089-1097 ◽  
Author(s):  
G. Morilla ◽  
D. Janssen ◽  
S. García-Andrés ◽  
E. Moriones ◽  
I. M. Cuadrado ◽  
...  
Keyword(s):  
Common Bean ◽  
Capsicum Annuum ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Severe Damage ◽  
Mild Strain ◽  
Dead End ◽  
Leaf Curl Virus ◽  
First Time ◽  
Leaf Curl

Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.

scholarly journals Detection and Sequence Diversity of Begomovirus Associated with Yellow Leaf Curl Disease of Pepper (Capsicum annuum) in West Sumatra, Indonesia

2009 ◽  
Vol 3 (2) ◽  
pp. 56-61 ◽  
Author(s):  
JUMSU TRISNO ◽  
SRI HENDRASTUTI HIDAYAT ◽  
TRIMURTI HABAZAR ◽  
ISHAK MANTI ◽  
JAMSARI JAMSARI
Keyword(s):  
Capsicum Annuum ◽  
Sequence Diversity ◽  
Yellow Leaf ◽  
West Sumatra ◽  
Leaf Curl Disease ◽  
Leaf Curl

scholarly journals First Report of Pepper Vein Yellows Virus and Pepper Yellow Leaf Curl Virus Infecting Chilli Pepper (Capsicum annuum) in Malaysia

Plant Disease ◽  
2020 ◽  
Vol 104 (7) ◽  
pp. 2037-2037
Author(s):  
A. R. Sau ◽  
N. M. F. Nazmie ◽  
M. S. M. Yusop ◽  
M. A. Akbar ◽  
M. F. M Saad ◽  
...  
Keyword(s):  
Capsicum Annuum ◽  
Yellow Leaf ◽  
Chilli Pepper ◽  
First Report ◽  
Leaf Curl Virus ◽  
Pepper Vein Yellows Virus ◽  
Leaf Curl

scholarly journals Identifikasi Molekuler Begomovirus Penyebab Penyakit Kuning Keriting pada Tanaman Cabai (Capsicum annum L.) di Sumatera Barat

2012 ◽  
Vol 13 (1) ◽  
pp. 41 ◽  
Author(s):  
Jumsu Trisno ◽  
Sri Hendrastuti Hidayat ◽  
Jamsari Jamsari ◽  
Trimuri Habazar ◽  
Ishak Manti
Keyword(s):  
Slight Modification ◽  
Amino Acid Sequences ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Coat Protein Region ◽  
West Sumatra ◽  
Total Dna ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Leaf Curl

Pepper plants showing Begomovirus-like symtoms, consisting of yellowing, leaf curling, and distortion, werecollected from fields located in the Padang, West Sumatra. The aim of this research is to identification ofbegomovirus associated with yellow leaf curl diseases on pepper. Total DNA was extracted from infected leaftissue according to Doyle and Doyle (1999) with slight modification. Polymerase chain reaction (PCR) was used toamplify the coat protein region of the virus using universal degenerate primers pAV494 and pAC1048. The PCRamplified DNA product (approx. 560 bp) was sequenced. The nucleotide and amino acid sequences and BLASTsearch revealed highest homology with pepper yellow leaf curl Indonesia virus isolated pepper, tomato andAgeratum conyzoides from Java, but differences from those of tomato yellow leaf curl virus. The isolate was thententatively called pepper yellow leaf curl Indonesia virus-Padang (PYLCIV-Pdg).

Control of the Bemisia tabaci/Tomato yellow leaf curl virus complex on protected tomato crops in Algarve (Portugal)*

EPPO Bulletin ◽  
2002 ◽  
Vol 32 (1) ◽  
pp. 31-35
Author(s):  
A. F. Arsenio ◽  
E. Neto ◽  
N. Ramos ◽  
S. Mangerico ◽  
E. Fortunato ◽  
...  
Keyword(s):  
Bemisia Tabaci ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Virus Complex ◽  
Leaf Curl Virus ◽  
Leaf Curl

Study of a collection of tomato hybrids with genetic resistance to the yellow leaf curl virus in Southern Russia

2020 ◽  
pp. 30-34
Author(s):  
С.Ф. Гавриш ◽  
Т.А. Редичкина ◽  
А.В. Буц ◽  
Г.М. Артемьева
Keyword(s):  
Resistance Genes ◽  
Molecular Genetic Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Mosaic Virus ◽  
Average Weight ◽  
Yellow Leaf ◽  
The South ◽  
Economically Valuable Traits ◽  
Leaf Curl Virus ◽  
Leaf Curl

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.

Sign in / Sign up

Export Citation Format

Share Document