scholarly journals Development of Real-Time Polymerase Chain Reaction Assay with TaqMan Probe for the Quantitative Detection of Infectious Hypodermal and Hematopoietic Necrosis Virus from Shrimp

2006 ◽  
Vol 89 (1) ◽  
pp. 240-244 ◽  
Author(s):  
Zhi-Qin Yue ◽  
Hong Liu ◽  
Wei-Ji Wang ◽  
Zhi-Wen Lei ◽  
Cheng-Zhu Liang ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Taqman Probe ◽  
Quantitative Detection ◽  
Necrosis Virus ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Polymerase Chain

Abstract An assay was developed for the detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) based on real-time quantitative polymerase chain reaction (PCR). A pair of primers and a TaqMan probe were designed that are specific for the recognition of a conservative region in the IHHNV genome. The IHHNV real-time PCR assay had a detection limit of 9 DNA copies,with a dynamic range of detection between 9 106 and 9 DNA copies. The primer pairs and probe were specific to IHHNV and did not cross-reactwith shrimp genomic DNAor other shrimp viruses such as White Spot Syndrome Virus (WSSV), Monodon Baculovirus (MBV), and hepatopancreatic parvovirus (HPV). This assay has a broad application for basic and clinical investigations. For clinical samples, the real-time PCR assay detected all the positive samples screened by conventional PCR, which indicated the sensitivity of the real-time assay. The IHHNV real-time PCR assay with high sensitivity, specificity, wide range of detection ability, and simplicity is particularly useful for screening large numbers of specimens and measuring viral loads to monitor the broodstock.

scholarly journals Validation of a Real-Time Polymerase Chain Reaction Assay for the Identification of Meloidogyne arenaria

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 835-838 ◽  
Author(s):  
Paula Agudelo ◽  
Stephen A. Lewis ◽  
Bruce A. Fortnum
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Soil Samples ◽  
Meloidogyne Arenaria ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Polymerase Chain ◽  
Species Specific

Meloidogyne arenaria is an economically important parasite of many crops worldwide. Identification and detection of this species in soil samples is necessary for the design of crop rotation systems, selection of resistant cultivars, and potential use of biological control options. The objective of this study was to develop and validate a real-time polymerase chain reaction (PCR) assay, using species-specific primers and SYBR Green I Dye, for identification of M. arenaria. The specificity of the assay was confirmed by testing for amplification of DNA from other Meloidogyne spp. and from M. arenaria populations of different geographic origins. Field soil samples containing a mixture of M. arenaria and M. incognita were used to compare identification by the real-time PCR assay with identification by esterase phenotype analysis of mature females and by morphometrics of juveniles. The real-time PCR assay provided an accurate and sensitive means for the identification of single juveniles from soil samples.

scholarly journals Sensitive Detection of Fusarium circinatum in Pine Seed by Combining an Enrichment Procedure with a Real-Time Polymerase Chain Reaction Using Dual-Labeled Probe Chemistry

2009 ◽  
Vol 99 (5) ◽  
pp. 582-590 ◽  
Author(s):  
Renaud Ioos ◽  
Céline Fourrier ◽  
Gabriela Iancu ◽  
Thomas R. Gordon
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Fusarium Circinatum ◽  
Conventional Pcr ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Polymerase Chain ◽  
Seed Dna

Fusarium circinatum is the causal agent of pitch canker disease on numerous Pinus spp. This aggressive fungus may infect pine seed cryptically and, therefore, can easily be spread long distances by the seed trade. F. circinatum has recently been listed as a quarantine organism in numerous countries throughout the world, which prompted the development of a specific and sensitive tool for the detection of this pathogen in conifer seed. A new detection protocol for F. circinatum based on a biological enrichment step followed by a real-time polymerase chain reaction (PCR) assay was developed. Several enrichment protocols were compared and a 72-h incubation of the seed with potato dextrose broth was the most efficient technique to increase F. circinatum biomass before DNA extraction. The relative accuracy, specificity, and sensitivity of the real-time PCR assay was evaluated in comparison with a previously published conventional PCR test on 420 seed DNA extracts. The real-time PCR described here proved to be highly specific and significantly more sensitive than the conventional PCR, and enabled the detection of F. circinatum in samples artificially contaminated with less than 1/1,000 infected seed, as well as in naturally infected samples. Last, in order to routinely check the quality of the seed DNA extracts, a primer–probe combination that targets a highly conserved region within the 18S ribosomal DNA in plants or fungi was successfully developed. This assay allows for quick and reliable detection of F. circinatum in seed, which can help to prevent long-distance spread of the pathogen via contaminated seed lots.

scholarly journals A Quantitative Real-time Polymerase Chain Reaction Assay for Botrytis aclada in Onion Bulb Tissue

HortScience ◽  
2008 ◽  
Vol 43 (2) ◽  
pp. 408-413 ◽  
Author(s):  
Timothy W. Coolong ◽  
Ronald R. Walcott ◽  
William M. Randle
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Pcr Assay ◽  
Polymerase Chain ◽  
And Storage ◽  
Assay Detection

A real-time polymerase chain reaction (PCR) assay has been developed for the detection and quantification of Botrytis aclada (Fresenius), a causal agent of neck rot in onion (Allium cepa L.) bulbs. The assay uses TaqMan probe-based chemistry to detect an amplicon from the L45-550 region of B. aclada while using a DNA sequence from the onion serine acetyl transferase gene (SAT1) as a control. The assay detection limits for B. aclada and onion were 10 pg·μL−1 of genomic DNA. The detection limit for lyophilized B. aclada mycelium was 1 μg. The presence of onion tissue in the samples did not affect the performance of the real-time PCR assay. The assay distinguished among different amounts of B. aclada mycelium growing on onion disks that were inoculated with 0, 102, or 104 B. aclada conidia. Visual observations during the incubation period corresponded with changes in real-time PCR results. This assay could be used to determine the amount of B. aclada mycelium in bulbs during growth, harvest, and storage, thus giving researchers an objective and efficient tool by which to quantify the growth rate and virulence of B. aclada strains in vivo.

Quantitative Real-Time Polymerase Chain Reaction Detection of BK Virus Using Labeled Primers

2010 ◽  
Vol 134 (3) ◽  
pp. 444-448 ◽  
Author(s):  
Zhengming Gu ◽  
Jianmin Pan ◽  
Matthew J. Bankowski ◽  
Randall T. Hayden
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Quantitative Polymerase Chain Reaction ◽  
Bk Virus ◽  
Clinical Samples ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain

Abstract Context.—BK virus infections among immunocompromised patients are associated with disease of the kidney or urinary bladder. High viral loads, determined by quantitative polymerase chain reaction (PCR), have been correlated with clinical disease. Objective.—To develop and evaluate a novel method for real-time PCR detection and quantification of BK virus using labeled primers. Design.—Patient specimens (n = 54) included 17 plasma, 12 whole blood, and 25 urine samples. DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science, Indianapolis, Indiana); sample eluate was PCR-amplified using the labeled primer PCR method. Results were compared with those of a user-developed quantitative real-time PCR method (fluorescence resonance energy transfer probe hybridization). Results.—Labeled primer PCR detected less than 10 copies per reaction and showed quantitative linearity from 101 to 107 copies per reaction. Analytical specificity of labeled primer PCR was 100%. With clinical samples, labeled primer PCR demonstrated a trend toward improved sensitivity compared with the reference method. Quantitative assay comparison showed an R2 value of 0.96 between the 2 assays. Conclusions.—Real-time PCR using labeled primers is highly sensitive and specific for the quantitative detection of BK virus from a variety of clinical specimens. These data demonstrate the applicability of labeled primer PCR for quantitative viral detection and offer a simplified method that removes the need for separate oligonucleotide probes.

Real-Time Polymerase Chain Reaction Detection of Bovine DNA in Meat and Bone Meal Samples

2002 ◽  
Vol 65 (7) ◽  
pp. 1158-1165 ◽  
Author(s):  
S. LAHIFF ◽  
M. GLENNON ◽  
J. LYNG ◽  
T. SMITH ◽  
N. SHILTON ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Meat And Bone Meal ◽  
Bone Meal ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Pcr Product ◽  
Pcr Products ◽  
Polymerase Chain

We describe a real-time polymerase chain reaction (PCR) assay for the detection of bovine DNA extracted from meat and bone meal (MBM) samples. PCR primers were used to amplify a 271-bp region of the mitochondrial ATPase 8–ATPase 6 gene, and a fluorogenic probe (BOV1) labeled with a 5′ FAM reporter and a 3′ TAMRA quencher was designed to specifically detect bovine PCR product. The specificity of the BOV1 probe for the detection of the bovine PCR product was confirmed by Southern blot hybridization analysis of the probe with PCR products generated from ovine, porcine, and bovine genomic DNA extracted from blood and with PCR products generated from genomic DNA extracted from single-species laboratory scale rendered MBM samples. The specificity of the BOV1 probe was also evaluated in real-time PCR reactions including these genomic targets. Both methods demonstrated that the BOV1 probe was specific for the detection of bovine PCR product. The BOV1 probe had a detection limit of 0.0001% bovine material by Southern blot DNA probe hybridization analysis and a detection limit of 0.001% bovine material in the real-time PCR assay. Application of the real-time PCR assay to six industrial samples that had previously tested positive for the presence of bovine material with a conventional PCR assay yielded positive results with the real-time PCR assay for four samples.

Quantitative detection of human enteric adenoviruses in river water by microfluidic digital polymerase chain reaction

2014 ◽  
Vol 70 (3) ◽  
pp. 555-560 ◽  
Author(s):  
Naohiro Kishida ◽  
Naohiro Noda ◽  
Eiji Haramoto ◽  
Mamoru Kawaharasaki ◽  
Michihiro Akiba ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
River Water ◽  
Water Samples ◽  
Real Time Pcr ◽  
Quantitative Detection ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Digital Polymerase Chain Reaction ◽  
Enteric Adenoviruses

We describe an assay for simple and accurate quantification of human enteric adenoviruses (EAdVs) in water samples using a recently developed quantification method named microfluidic digital polymerase chain reaction (dPCR). The assay is based on automatic distribution of reaction mixture into a large number of nanolitre-volume reaction chambers and absolute copy number quantification from the number of chambers containing amplification products on the basis of Poisson statistics. This assay allows absolute quantification of target genes without the use of standard DNA. Concentrations of EAdVs in Japanese river water samples were successfully quantified by the developed dPCR assay. The EAdVs were detected in seven of the 10 samples (1 L each), and the concentration ranged from 420 to 2,700 copies/L. The quantified values closely resemble those by most probable number (MPN)-PCR and real-time PCR when standard DNA was validated by dPCR whereas they varied substantially when the standard was not validated. Accuracy and sensitivity of the dPCR was higher than those of real-time PCR and MPN-PCR. To our knowledge, this is the first study that has successfully quantified enteric viruses in river water using dPCR. This method will contribute to better understanding of existence of viruses in water.

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Rattus Norvegicus ◽  
In Silico ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

scholarly journals Molecular diagnosis of Anaplasma marginale in cattle: quantitative evaluation of a real-time PCR (Polymerase Chain Reaction) based on msp5 gene

2014 ◽  
Vol 34 (1) ◽  
pp. 29-33 ◽  
Author(s):  
Gisele M. Bacanelli ◽  
Carlos A. N. Ramos ◽  
Flábio R. Araújo
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Anaplasma Marginale ◽  
Diagnostic Methods ◽  
Molecular Diagnostic ◽  
Chain Reaction ◽  
The Real ◽  
End Point ◽  
Polymerase Chain

The rickettsia Anaplasma marginale is considered the main agent of bovine anaplasmosis. Due the nonspecific clinical signs of the anaplasmosis, the diagnosis of infection depends of laboratory confirmation. In recent years, molecular diagnostic methods have been used to detect A. marginale in cattle. However, the existence of a large number of assays of different sensitivity and cost makes the choice of an appropriate test difficult. In the present study, a real-time Polymerase Chain Reaction (PCR) based on the msp5 target gene was quantitatively assessed and compared to an end point PCR. Both reactions were subjected to sensitivity and specificity evaluation using plasmid DNA and samples from cattle experimentally infected with A. marginale. A comparative field trial of the tests was carried out using samples of cattle from a stable enzootic area for A. marginale. The real-time PCR showed a higher sensitivity than the end point PCR. This reaction (i.e. real-time PCR) was able to detect one copy of the msp5 gene in 100 ηg of plasmidial DNA, and more than 80% of its results were positive among experimentally infected animals seven days after infection. In addition, based on in silico analysis, the real-time PCR evaluated in the present study appears to be useful for the detection of A. ovis.

scholarly journals Quantification of Magnaporthe grisea During Infection of Rice Plants Using Real-Time Polymerase Chain Reaction and Northern Blot/Phosphoimaging Analyses

2002 ◽  
Vol 92 (8) ◽  
pp. 870-876 ◽  
Author(s):  
Min Qi ◽  
Yinong Yang
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Northern Blot ◽  
Host Resistance ◽  
Real Time Pcr ◽  
Magnaporthe Grisea ◽  
Chain Reaction ◽  
Fungal Pathogenicity ◽  
The Real ◽  
Polymerase Chain

Rice blast, caused by Magnaporthe grisea, is a serious fungal disease of rice worldwide. Currently, evaluation of the fungal pathogenicity and host resistance is mainly based on a disease rating or measurement of blast lesion number and size. However, these methods only provide visual estimation rather than accurate measurement of fungal growth in rice plants. In this study, DNA-based real-time polymerase chain reaction (PCR) and RNA-based northern blot/phosphoimaging analyses were evaluated to quantify M. grisea. Both methods were sensitive, specific, and reproducible and could accurately measure the relative growth and absolute biomass of M. grisea. The real-time PCR analysis showed that the growth of M. grisea in seedling leaves of susceptible cultivars (M201 and Wells) was ≈46 to 80 times higher than that of a resistant cultivar (Drew) at 4 and 6 days after inoculation. The data obtained from the real-time PCR assays also were consistent with that from northern blot/ phosphoimaging analysis. However, the real-time PCR approach was much faster and more convenient in most cases. Therefore, it is an excellent tool for in planta quantification of M. grisea and can be used for reliable assessment of fungal pathogenicity and host resistance

Sign in / Sign up

Export Citation Format

Share Document