scholarly journals First Report of 16S rDNA II Group Phytoplasma on Polygala mascatense, a Weed in Oman

Plant Disease ◽  
2006 ◽  
Vol 90 (2) ◽  
pp. 248-248 ◽  
Author(s):  
S. Livingston ◽  
M. O. Al-Azri ◽  
N. A. Al-Saady ◽  
A. M. Al-Subhi ◽  
A. J. Khan
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Pcr Amplification ◽  
Perennial Herb ◽  
Direct Pcr ◽  
First Report ◽  
Palm Trees ◽  
National Botanic Garden ◽  
Negative Controls ◽  
Positive Controls

Polygala mascatense Boiss. (family Polygalaceae) is a common weed found in neglected farms, under date palm trees, and in stony locations throughout the Sultanate of Oman (1). It is a perennial herb approximately 30 to 40 cm tall, has slender branches, is woody at the base, and has linear leaves with purple flowers. Recently (November 2004), in the interior region of Oman (210 km south of Muscat), some polygala plants were found stunted with small leaves, bushy growth, and the floral parts were showing phyllody symptoms. Total genomic DNA extracted from asymptomatic and symptomatic plants with modified cetyltrimethylammoniumbromide (CTAB) buffer method (4) was used as a template for direct polymerase chain reaction (PCR) amplification of phytoplasma 16S rDNA with P1/P7 primers. Direct PCR product was used as template DNA for nested PCR with primers R16F2n/R16R2. DNA from plants infected with alfalfa and lime witches'-broom phytoplasma was used as positive controls, and DNA from healthy plants and water was used as negative controls. Products from nested PCR (1.2 kb) were analyzed by using single endonuclease enzyme digestion (restriction fragment length polymorphism [RFLP]) with Tru9I, HaeIII, HhaI, TaqI, AluI, and RsaI (3). The results showed the presence of a 1.8-kb product amplified with direct PCR and a 1.2-kb product of the nested PCR from infected polygala and the positive controls, whereas no PCR products were observed in the negative controls. The PCR assay confirmed the presence of phytoplasma causing witches'-broom disease in polygala. The RFLP results showed the polygala phyto-plasma to be most similar to the alfalfa phytoplasma, a member of 16SrII group (2). Infected polygala weeds may serve as a reservoir for alfalfa witches'-broom phytoplasma that causes annual losses over $25 million to alfalfa cultivation in Oman (2). A detailed investigation needs to be carried out to establish transmission of phytoplasma from polygala to alfalfa. To our knowledge, this is the first report of phytoplasma infecting polygala weeds in Oman. References: (1) S. A. Ghazanfar. Pages 95–96 in: An Annotated Catalogue of the Vascular Plants in Oman. Scripta Botanica Belgica Meise, National Botanic Garden of Belgium, 1992. (2) A. J. Khan et al. Phytopathology 92:1038, 2002. (3) I. M. Lee et al. Int. J. Syst. Bacteriol. 1153, 1998. (4) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA 81:8014, 1984.

scholarly journals First Report of Witches'-Broom Disease of Sesame (Sesamum indicum) in Oman

Plant Disease ◽  
2005 ◽  
Vol 89 (5) ◽  
pp. 530-530 ◽  
Author(s):  
M. A. Al-Sakeiti ◽  
A. M. Al-Subhi ◽  
N. A. Al-Saady ◽  
M. L. Deadman
Keyword(s):  
Nested Pcr ◽  
Restriction Enzymes ◽  
Negative Control ◽  
Direct Pcr ◽  
First Report ◽  
Pcr Products ◽  
Broom Disease ◽  
Short Shoots ◽  
Template Dna ◽  
Positive Controls

Sesame is the major oil seed crop in Oman. During 2004, disease symptoms were observed at Nizwa, 175 km south of Muscat. Symptoms included phyllody and excessive development of short shoots and internodes resulting in little leaves. Total genomic DNA was extracted from healthy and symptomatic plants with a modified cetyltrimethylammoniumbromide (CTAB) buffer method (2). DNA samples were assayed by polymerase chain reaction (PCR), with the 16S rDNA amplified using primers P1 and P7. Direct PCR products were used as template DNA for nested PCR with primers R16F2n and R16R2. Direct PCR products were analyzed by restriction fragment length polymorphism (RFLP) with four restriction enzymes, Tru9I, HaeIII, HhaI, and RsaI. DNAs from alfalfa and lime plants infected by witches'-broom phytoplasmas were used as positive controls and DNA from healthy plants and water were negative controls. The results showed the presence of a 1.8-kb product amplified with the direct PCR and a 1.2-kb product of the nested PCR from infected sesame and the positive controls. No PCR product was observed in the negative control. The PCR assay confirmed the presence of phytoplasma causing witches'-broom disease in sesame. The RFLP results showed the sesame phytoplasma to be most similar to the alfalfa phytoplasma, a member of 16SrII group (1). To our knowledge, this is the first report of a phytoplasma of the 16Sr II group causing witches'-broom disease on sesame in the Sultanate of Oman. References: (1) A. J. Khan et al. Phytopathology 92:1038, 2002. (2) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA, 81:8014, 1984.

scholarly journals First Report of a Group 16SrII Phytoplasma Associated with Witches'-Broom of Eggplant in Oman

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 360-360 ◽  
Author(s):  
A. M. Al-Subhi ◽  
N. A. Al-Saady ◽  
A. J. Khan ◽  
M. L. Deadman
Keyword(s):  
Nested Pcr ◽  
Solanum Melongena ◽  
Positive Control ◽  
Rrna Gene ◽  
Direct Pcr ◽  
First Report ◽  
Pcr Product ◽  
Pcr Products ◽  
Broom Disease ◽  
Phytoplasma Infection

Eggplant (Solanum melongena L.) belongs to the family Solanaceae and is an important vegetable cash crop grown in most parts of Oman. In February 2010, plants showing phyllody symptoms and proliferation of shoots resembling those caused by phytoplasma infection were observed at Khasab, 500 km north of Muscat. Total genomic DNA was extracted from healthy and two symptomatic plants with a modified (CTAB) buffer method (2) and analyzed by direct and nested PCR with universal phytoplasma 16S rDNA primers P1/P7 and R16F2n/ R16R2, respectively. PCR amplifications from all infected plants yielded an expected product of 1.8 kb with P1/P7 primers and a 1.2-kb fragment with nested PCR, while no products were evident with DNA from healthy plants. Restriction fragment length polymorphism (RFLP) profiles of the 1.2-kb nested PCR products of two eggplant phyllody phytoplasma and five phytoplasma control strains belonging to different groups used as positive control were generated with the restriction endonucleases RsaI, AluI, Tru9I, T-HB8I, and HpaII. The eggplant phytoplasma DNA yielded patterns similar to alfalfa witches'-broom phytoplasma (GenBank Accession No. AF438413) belonging to subgroup 16SrII-D, which has been recorded in Oman (1). The DNA sequence of the 1.8-kb direct PCR product was deposited in GenBank (Accession No. HQ423156). Sequence homology results using BLAST revealed that the eggplant phyllody phytoplasma shared >99% sequence identity with Scaevola witches'-broom phytoplasma (Accession No. AB257291.1), eggplant phyllody phytoplasma (Accession No. FN257482.1), and alfalfa witches'-broom phytoplasma (Accession No. AY169323). The RFLP and BLAST results of 16S rRNA gene sequences confirm that eggplant phyllody phytoplasma is similar to the alfalfa phytoplasma belonging to subgroup 16SrII-D. To our knowledge, this is the first report of a phytoplasma of the 16SrII-D group causing witches'-broom disease on eggplant in Oman. References: (1) A. J. Khan et al. Phytopathology 92:1038, 2002. (2) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA, 81:8014, 1984.

scholarly journals First Report of an Aster Yellows Phytoplasma Associated with Cabbage in Southern Texas

Plant Disease ◽  
2001 ◽  
Vol 85 (4) ◽  
pp. 447-447 ◽  
Author(s):  
I.-M. Lee ◽  
R. A. Dane ◽  
M. C. Black ◽  
Noel Troxclair
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Restriction Enzymes ◽  
Diagnostic Procedures ◽  
Acid Extraction ◽  
Insect Vector ◽  
Aster Yellows ◽  
First Report ◽  
Pcr Products ◽  
Aster Yellows Phytoplasma

In early spring 2000 carrot crops in southwestern Texas were severely infected by an outbreak of phyllody associated with aster yellows phytoplasma. Cabbage crops that had been planted adjacent to these carrot fields began to display previously unobserved symptoms characteristic of phytoplasma infection. Symptoms included purple discoloration in leaf veins and at the outer edges of leaves on cabbage heads. Proliferation of sprouts also occurred at the base of the stem and between leaf layers of some plants, and sprouts sometimes continued to proliferate on extended stems. About 5% of cabbage plants in the field exhibited these symptoms. Two symptomless and four symptomatic cabbage heads were collected in early April from one cabbage field. Veinal tissues were stripped from each sample and used for total nucleic acid extraction. To obtain specific and sufficient amount of PCR products for analysis, nested PCR was performed by using primer pairs (first with P1/P7 followed by R16F2n/R16R2) (1,2) universal for phytoplasma detection. A specific 16S rDNA fragment (about 1.2 kb) was strongly amplified from the four symptomatic but not from the two asymptomatic samples. The nested PCR products obtained from the four symptomatic samples were then analyzed by restriction fragment length polymorphism (RFLP) using the restriction enzymes MseI, HhaI, and HpaII, and the RFLP patterns were compared to the published patterns of known phytoplasmas (1). The resulting RFLP patterns were identical to those of a phytoplasma belonging to subgroup B of the aster yellows phytoplasma group (16SrI). These RFLP patterns were also evident in putative restriction sites observed in a 1.5 kbp nucleotide sequence of the 16S rDNA. This is the first report of aster yellows phytoplasma associated disease symptoms in cabbage in Texas. The occurrence of cabbage proliferation coincided with the presence of high populations of the insect vector, aster leafhopper. References: (1) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (2) B. Schneider et al. 1995. Molecular and Diagnostic Procedures in Mycoplasmology, Vol. I. Academic Press, San Diego, CA.

scholarly journals First Report on the Molecular Identification of Phytoplasma (16SrII-D) Associated with Witches' Broom of Kalmegh (Andrographis paniculata) in India

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 155-155 ◽  
Author(s):  
S. T. Saeed ◽  
A. Khan ◽  
A. Samad
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Disease Incidence ◽  
Antioxidant Properties ◽  
First Record ◽  
Andrographis Paniculata ◽  
Medicinal And Aromatic Plants ◽  
First Report ◽  
16S Rdna Sequence Analysis ◽  
Virtual Rflp

Andrographis paniculata (family Acanthaceae), also known as “King of Bitters” or Kalmegh, is an important medicinal plant used for the treatment of various diseases. It has antimicrobial, antiviral, anti-inflammatory, hepatoprotective, antidiabetic, antihyperglycemic, and antioxidant properties (1). During June 2014, while performing a routine survey of the commercial trial fields of Kalmegh at Central Institute of Medicinal and Aromatic Plants (CIMAP), Lucknow, India, typical phytoplasma disease symptoms such as virescence, proliferation, and witches' broom along with little leaf and stunted growth were observed. The disease incidence was estimated to be approximately 7 to 10%. To ascertain the presence of phytoplasma, 16 samples of leaves were collected from nine different field sites, and total genomic DNA was extracted from the symptomatic and symptomless Kalmegh plants by the CTAB method. Direct and nested PCR assays were performed targeting the 16S rDNA using generic phytoplasma primer pairs P1/P6 followed by R16F2n/R16R2 (2). Resulting bands of the expected size (1.5 kb and 1.2 kb, respectively) were amplified from symptomatic plants. No amplification was observed with DNA from asymptomatic plant samples. The purified nested PCR products were cloned into E. coli DH5α, using the pGEM-T Easy vector (Promega, United States) and sequenced with primers M13For/M13Rev using an automatic sequencer (ABI Prism, Perkin Elmer) at CIMAP. The sequence was analyzed by BLASTn and found to share 99% similarity with Echinacea witches'-broom phytoplasma and Sesame phyllody phytoplasma strain (GenBank Accession Nos. JF340080 and KF612966, respectively), which belong to the 16SrII-D group. The sequence was deposited in NCBI as GenBank Accession No. KM359410. A phylogenetic tree using MEGA v5.0 (4) was constructed with 16S rDNA; consensus sequences of phytoplasmas belonging to distinct groups revealed that the present phytoplasma clustered with the 16SrII group. iPhyClassifier software was used to perform sequence comparison and generate a virtual restriction fragment length polymorphism (RFLP) profile (5). On the basis of iPhyClassifier, the 16S rDNA sequence analysis of our isolate showed 99.2% similarity with that of the ‘Candidatus Phytoplasma australasiae’ reference strain (GenBank Accession No. Y10097), which belongs to 16Sr group II. The virtual RFLP pattern of F2n/R2 fragment was most similar to the 16SrII-D subgroup (similarity coefficient of 0.91) but showed a difference in profile with HpaI, HhaI, and MseI enzymes. Several bacterial/fungal and viral diseases have been reported on A. paniculata (3); however, to our knowledge, this is the first report of witches' broom disease in India and the first record of a 16SrII-D group phytoplasma on Kalmegh. Its presence in Kalmegh is of great significance due to its commercial interest. References: (1) S. Akbar. Altern. Med. Rev. 16:1, 2011. (2) D. E. Gundersen and M. Lee. Phytopathol. Mediterr. 35:144, 1996. (3) A. Khan and A. Samad. Plant Dis. 98:698, 2014. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (5) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

scholarly journals First Report of Candidatus Phytoplasma solani Associated with Potato Plants in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1739-1739 ◽  
Author(s):  
M. C. Holeva ◽  
P. E. Glynos ◽  
C. D. Karafla ◽  
E. M. Koutsioumari ◽  
K. B. Simoglou ◽  
...  
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Pathogenic Bacteria ◽  
Related Strain ◽  
Northern Greece ◽  
First Report ◽  
Potato Plants ◽  
Pcr Product ◽  
16S Rdna Pcr ◽  
Stolbur Phytoplasma

In August 2013, potato plants (Solanum tuberosum) cv. Banba displaying symptoms resembling those caused by Candidatus Phytoplasma solani (potato stolbur phytoplasma) were observed in a 2-ha field in the area of the Peripheral Unit of Drama (northern Greece). The plants were 10 weeks old and their symptoms included reddening and upward rolling of leaflets, reduced size of leaves, shortened internodes, and aerial tuber formation. Incidence of affected plants was estimated to be 40% in the field. Four symptomatic potato plants were collected for laboratory testing of possible phytoplasma infection. From each of these four plants, total DNA was extracted from mid veins of reddish leaflets from apical shoot parts and of leaflets emerging from aerial tubers, using a phytoplasma enrichment procedure (1). A nested PCR using the phytoplasma universal 16S rRNA primer pairs: P1/P7 followed by R16F2n/R16R2 (3) amplified the expected ~1.2-kb 16S rDNA fragment in all four symptomatic potato plants. No amplification was observed with DNA similarly extracted from leaflets of asymptomatic potato plants of the same variety collected from an apparently healthy crop. One of the four 1.2-kb nested 16S rDNA PCR products was gel purified, cloned into the pGEM-T-easy plasmid vector (Promega, Madison, WI), and sequenced by Beckman Coulter Genomics (United Kingdom). At least twofold coverage per base position of the cloned PCR product was achieved. BLAST analysis showed that the obtained sequence of the PCR 16S rDNA product was: i) 100% identical to several GenBank sequences of Ca. P. solani strains, including strains detected previously in Greece infecting tomato (GenBank Accession No. JX311953) and Datura stramonium (HE598778 and HE598779), and ii) 99.7% similar to that of the Ca. P. solani reference strain STOL11 (AF248959). Furthermore, analysis by iPhyClassifier software showed that the virtual restriction fragment length polymorphism (RFLP) pattern of the sequenced PCR 16S rDNA product is identical (similarity coefficient 1.00) to the reference pattern of the 16SrXII-A subgroup (AF248959). The sequence of this PCR product was deposited in NCBI GenBank database under the accession no. KJ810575. The presence of the stolbur phytoplasma in all four symptomatic potato plants examined was further confirmed by nested PCR using the stolbur-specific STOL11 primers (3) targeting non-ribosomal DNA. Based on the observed symptoms in the field and laboratory molecular examinations, we concluded that the potato plants were infected by a Ca. P. solani related strain. The stolbur disease has been previously reported in Greece affecting tomato (2,5) and varieties of D. stramonium (4). To our knowledge, this is the first report of a Ca. P. solani related strain infecting a potato crop in Greece. As northern Greece is a center of potato production, the source of this pathogen is to be investigated. References: (1) U. Ahrens and E. Seemuller. Phytopathology 82:828, 1992. (2) A. S. Alivizatos. Pages 945-950 in: Proceedings of the 7th International Conference of Plant Pathogenic Bacteria. Academiai Kiado, Budapest, Hungary, 1989. (3) J. Jović et al. Bull. Insectol. 64:S83, 2011. (4) L. Lotos et al. J. Plant Pathol. 95:447, 2013. (5) E. Vellios and F. Lioliopoulou. Bull. Insectol. 60:157, 2007.

scholarly journals First Report of Aster Yellows Phytoplasma in Alfalfa

Plant Disease ◽  
1999 ◽  
Vol 83 (5) ◽  
pp. 488-488 ◽  
Author(s):  
R. D. Peters ◽  
M. E. Lee ◽  
C. R. Grau ◽  
S. J. Driscoll ◽  
R. M. Winberg ◽  
...  
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Sequence Data ◽  
Sequence Similarity ◽  
Similarity Function ◽  
Sterile Water ◽  
Aster Yellows ◽  
First Report ◽  
Pcr Product ◽  
Aster Yellows Phytoplasma

Samples of alfalfa (Medicago sativa L.) leaves and stems showing symptoms of inter-veinal chlorosis and purpling, commonly associated with insect feeding, were collected from 8 sites in central and southern Wisconsin in autumn of 1998. Samples were frozen within 24 h of collection. Approximately 0.3 g of plant tissue from each sample was used for total DNA extraction according to the protocol of Zhang et al. (4), with minor modifications in grinding procedures and reagent volumes to optimize results. Nested polymerase chain reaction (PCR) was carried out by amplification of 16S rDNA with the universal primer pairs R16mF2/R16mR1 followed by R16F2n/R16R2 as described by Gunder-sen and Lee (1). Undiluted total sample DNA was used for the first amplification; PCR products were diluted (1:30) in sterile water prior to final amplification. Alfalfa DNA and sterile water were used as negative controls; DNA from phytoplasma causing X-disease in peach (CX) served as a positive control. Fragments of 16S rDNA from putative phytoplasmas amplified by PCR with the primer pair R16F2n/R16R2 were characterized by restriction endonuclease digestion (3). The resulting restriction fragment length polymorphism (RFLP) patterns were compared with patterns for known phytoplasmas described by Lee et al. (3). Products of nested PCR were also purified and sequenced with primers R16F2n/R16R2 and an automated DNA sequencer (ABI 377XL; C. Nicolet, Biotechnology Center, University of Wisconsin-Madison). Of 51 samples of alfalfa assessed, one sample from Evansville, WI, yielded a nested PCR product of the appropriate size (1.2 kb), indicating the presence of phytoplasma. Digestion of this product with various restriction enzymes produced RFLP patterns that were identical to those for phytoplasmas in the aster yellows phytoplasma subgroup 16SrI-A (3). Alignment of the DNA sequence of the nested PCR product from the positive sample with sequences found in the GenBank sequence data base (National Center for Biotechnology Information, Bethesda, MD) with the BLAST sequence similarity function confirmed this result. Although other phytoplasma strains (particularly those causing witches'-broom) have been reported to infect alfalfa (2), this is the first report of the presence of the aster yellows phytoplasma in the alfalfa crop. Vectors involved in transmission and the potential agronomic impacts of aster yellows phytoplasma in alfalfa are topics of current investigation. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) A.-H. Khadhair et al. Microbiol. Res. 152:269, 1997. (3) I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (4) Y.-P. Zhang et al. J. Virol. Methods 71:45, 1998.

scholarly journals First Report of Botryosphaeria rhodina Causing Shoot Blight of Pistachio in California

Plant Disease ◽  
2002 ◽  
Vol 86 (11) ◽  
pp. 1273-1273 ◽  
Author(s):  
T. J. Michailides ◽  
D. P. Morgan ◽  
D. Felts ◽  
J. Phillimore
Keyword(s):  
Current Season ◽  
First Report ◽  
Mycelial Plug ◽  
Shoot Blight ◽  
Botryosphaeria Rhodina ◽  
Pathogenicity Tests ◽  
Cork Borer ◽  
Negative Controls ◽  
Positive Controls ◽  
Pistachio Trees

In the summers of 2000 and 2001, shoot blight was observed in pistachios (Pistacia vera L.) grown in Kern County, California. Black, necrotic lesions developed at the base of shoots originating from contaminated or partially infected buds. Infection moved upward resulting in a progressive wilting and blighting of leaves. Leaf blades on infected shoots withered, and petioles became necrotic. Symptoms have been considered characteristic of infection by Botryosphaeria dothidea (Moug.:Fr.) Ces. & de Not., but this pathogen causes panicle and shoot blight of pistachio (1). However, there were no symptoms of any fruit panicle infections on trees we observed. Isolations on acidified potato dextrose agar from the base of blighted shoots in both years revealed a fast-growing fungus producing pycnidia which was identified as the anamorph Lasiodiplodia theobromae (Pat.) Griffon & Maubl. of B. rhodina Berk. & Curt. Arx. Identification of the pathogen was based on characteristic dark brown, oval pycnidiospores with striations on the surface of the spore along the long axis. Pathogenicity tests were performed on 12 Kerman pistachio trees grown at Kearney Agricultural Center, in Parlier, CA, using three isolates recovered from pistachios grown in two locations. Six to 16 current season shoots of pistachio trees (1 to 2 shoots per tree) were wounded with a 5-mm-diameter cork borer, and a mycelial plug of 5-day-old cultures of B. rhodina was inserted in each wound. Shoots were wrapped with Parafilm to prevent desiccation of inoculum. Six other shoots (one per tree) were inoculated similarly with mycelial agar plugs of a pistachio isolate of B. dothidea and served as positive controls, while six similar shoots were inoculated with only agar plugs and served as negative controls. Wilting of lower leaves in the majority of inoculated shoots started within 4 days for B. rhodina and 7 days for B. dothidea. Depending on the isolate of B. rhodina, 1 to 5 shoots and 50 to 80% of leaves were blighted within 7 days after inoculation. All inoculated shoots were left on the trees until 3 to 4 months after inoculation, pruned and assessed again. For inoculations done in September 2001, 33 to 71% of shoots were blighted, and the rest had cankers ranging from 22.5 to 28 mm long and 13.5 to 23.5 mm wide. A majority (67 to 100%) of shoots had pycnidia of the pathogen present. For inoculations done in October 2001, none of the shoots was blighted, but cankers ranged from 5 to 55.4 mm long and 6 to 22 mm wide and 33.3 to 100% developed pycnidia. B. rhodina was isolated from all inoculated shoots but not from negative controls or those inoculated with B. dothidea. Inoculations of shoots with B. dothidea produced similar symptoms as those of B. rhodina. Shoots that served as negative controls did not develop symptoms. Because panicle and shoot blight of pistachio caused by B. dothidea has developed to epidemic levels in commercial pistachio orchards and is of concern to the pistachio industry in California, it would be of interest to monitor how much shoot blight caused by B. rhodina would eventually develop over the years in commercial pistachio orchards. A survey was initiated in 2002 to determine how widespread B. rhodina is in California pistachios. To our knowledge, this is the first report worldwide of B. rhodina causing shoot blight of pistachio. Reference: (1) T. Michailides. Panicle and shoot blight. Page 68 in: Compendium of Nut Crop Diseases in Temperate Zones. B. L. Teviotdale, T. J. Michailides, and J. W. Pscheidt, eds. American Phytopathological Society, St. Paul, MN 2002.

scholarly journals First Report of Potato mop-top virus on Potato in Poland

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 920-920 ◽  
Author(s):  
M. Budziszewska ◽  
P. Wieczorek ◽  
K. Nowaczyk ◽  
N. Borodynko ◽  
H. Pospieszny ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Potato Production ◽  
Amino Acid Identity ◽  
Sequence Comparisons ◽  
First Report ◽  
Pcr Products ◽  
Potato Mop Top Virus ◽  
Negative Controls ◽  
North And South America ◽  
Das Elisa

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5′GGTTTGTTTACCACCCTTGG3′ (3) and PMTV2 5′AAAAGCCTGAGCGGTTAATTG3′ (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

scholarly journals First Report of a 16SrIX Group (Pigeon Pea Witches'-Broom) Phytoplasma Associated with Sesame Phyllody in Turkey

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
M. Catal ◽  
C. Ikten ◽  
E. Yol ◽  
R. Üstün ◽  
B. Uzun
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Disease Incidence ◽  
Natural Infection ◽  
Reference Sequence ◽  
Universal Primers ◽  
Flower Formation ◽  
Disease Symptoms ◽  
First Report ◽  
Rflp Profile

Sesame (Sesamum indicum L.) is an important oilseed crops widely grown in the southern regions of Turkey. Sesame seeds are primarily used in production of tahini as well as a garnish on sweets and bakery products in the country. Sesame plants with phyllody disease symptoms have increasingly been observed in the fields of Antalya province since 2007. The disease incidence in these fields was found to range from 37 to 62% (2). Infected plants display a variety of the disease symptoms such as virescence, asymptomatic shoot proliferation, infertile flower formation, reduced leaf size, and thin and weak capsule development. Total genomic DNA was extracted from samples collected from symptomatic (10 plants) and asymptomatic healthy-looking plants (10 plants) using a CTAB method and amplified with universal primers P1/P7 and R16F2n/R16R2 in direct and nested PCR, respectively (1,3). Amplifications of the DNA from the symptomatic plants yielded a product of 1.8 kb in direct and 1.2 kb in nested PCR assays. No amplification was observed in symptomless plants of the same age and collected from the same fields. Amplicons were purified, cloned in a pTZ57R/T Vector, and sequenced using a Beckman Coulter 8000 CEQ Genetic Analysis System. Four aligned 16S rDNA sequences (1,845 bp) were found to be all identical and belonging to one species. One sequence was deposited in GenBank under the accession number KC139791. A BLAST similarity search revealed that the sequence shared 99% homology with the sequences of the members of 16SrIX group phytoplasmas, ‘Brassica rapa’ phyllody phytoplasma (HM559246.1) and Iranian Almond witches'-broom phytoplasma (DQ195209.1) available in GenBank. In addition, iPhyClassifier software (4) was employed to create a virtual RFLP profile. The analysis showed that the RFLP profile of the sesame phytoplasma 16S rDNA sequence is identical (a similarity coefficient of 1.00) to the profile of the 16Sr group IX phytoplasma reference sequence (Y16389). A phylogenetic tree was also constructed using the neighbor joining plot option of the Clustal X program. The sequence clustered together with 16SrIX group phytoplasmas. To our knowledge, this is the first report of a natural infection of sesame by a new phytoplasma species from the 16SrIX group in Turkey. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) C. Ikten et al. Phytopathogenic Mollicutes 1:101, 2011. (3) C. D. Smart et al. Appl. Environ. Microbiol. 62:2988, 1996. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

scholarly journals First Report of Two Distinct Phytoplasma Species, ‘Candidatus Phytoplasma cynodontis’ and ‘Candidatus Phytoplasma asteris,’ Simultaneously Associated with Yellow Decline of Wodyetia bifurcata (Foxtail Palm) in Malaysia

Plant Disease ◽  
2013 ◽  
Vol 97 (11) ◽  
pp. 1504-1504 ◽  
Author(s):  
N. Naderali ◽  
N. Nejat ◽  
Y. H. Tan ◽  
G. Vadamalai
Keyword(s):  
16S Rdna ◽  
Nested Pcr ◽  
Rflp Analysis ◽  
Rrna Gene ◽  
Gene Sequences ◽  
First Report ◽  
White Leaf ◽  
General Decline ◽  
Pcr Products ◽  
Plant Pathol

The foxtail palm (Wodyetia bifurcata), an Australian native species, is an adaptable and fast-growing landscape tree. The foxtail palm is most commonly used in landscaping in Malaysia. Coconut yellow decline (CYD) is the major disease of coconut associated with 16SrXIV phytoplasma group in Malaysia (1). Symptoms consistent with CYD, such as severe chlorosis, stunting, general decline, and death were observed in foxtail palms from the state of Selangor in Malaysia, indicating putative phytoplasma infection. Symptomatic trees loses their green and vivid appearance as a decorative and landscape ornament. To determine the presence of phytoplasma, samples were collected from the fronds of 12 symptomatic and four asymptomatic palms in September 2012, and total DNA was extracted using the CTAB method (3). Phytoplasma DNA was detected in eight symptomatic palms using nested PCR with universal phytoplasma 16S rDNA primer pairs, P1/P7 followed by R16F2n/R16R2 (2). Amplicons (1.2 kb in length) were generated from symptomatic foxtail palms but not from symptomless plants. Phytoplasma 16S rDNAs were cloned using a TOPO TA cloning kit (Invitrogen). Several white colonies from rDNA PCR products amplified from one sample with R16F2n/R16R2 were sequenced. Phytoplasma 16S rDNA gene sequences from single symptomatic foxtail palms showed 99% homology with a phytoplasma that causes Bermuda grass white leaf (AF248961) and coconut yellow decline (EU636906), which are both members of the 16SrXIV ‘Candidatus Phytoplasma cynodontis’ group. The sequences also showed 99% sequence identity with the onion yellows phytoplasma, OY-M strain, (NR074811), from the ‘Candidatus Phytoplasma asteris’ 16SrI-B subgroup. Sequences were deposited in the NCBI GenBank database (Accession Nos. KC751560 and KC751561). Restriction fragment length polymorphism (RFLP) analysis was done on nested PCR products produced with the primer pair R16F2n/R16R2. Amplified products were digested separately with AluI, HhaI, RsaI, and EcoRI restriction enzymes based on manufacturer's specifications. RFLP analysis of 16S rRNA gene sequences from symptomatic plants revealed two distinct profiles belonging to groups 16SrXIV and 16SrI with majority of the 16SrXIV group. RFLP results independently corroborated the findings from DNA sequencing. Additional virtual patterns were obtained by iPhyclassifier software (4). Actual and virtual patterns yielded identical profiles, similar to the reference patterns for the 16SrXIV-A and 16SrI-B subgroups. Both the sequence and RFLP results indicated that symptoms in infected foxtail palms were associated with two distinct phytoplasma species in Malaysia. These phytoplasmas, which are members of two different taxonomic groups, were found in symptomatic palms. Our results revealed that popular evergreen foxtail palms are susceptible to and severely affected by phytoplasma. To our knowledge, this is the first report of a mixed infection of a single host, Wodyetia bifurcata, by two different phytoplasma species, Candidatus Phytoplasma cynodontis and Candidatus Phytoplasma asteris, in Malaysia. References: (1) N. Nejat et al. Plant Pathol. 58:1152, 2009. (2) N. Nejat et al. Plant Pathol. J. 9:101, 2010. (3) Y. P. Zhang et al. J. Virol. Meth. 71:45, 1998. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

Sign in / Sign up

Export Citation Format

Share Document