scholarly journals First Report of Carnation mottle virus in Phalaenopsis Orchids

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 354-354 ◽  
Author(s):  
Y.-X. Zheng ◽  
C.-C. Chen ◽  
F.-J. Jan
Keyword(s):  
Amino Acid ◽  
Ringspot Virus ◽  
Mottle Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Electron Microscopic ◽  
First Report ◽  
Cp Gene ◽  
Plant Pathol ◽  
Conserved Region ◽  
Carnation Mottle Virus

In November 2003, two Phalaenopsis orchids from two different nurseries with symptoms of chlorotic rings on leaves were observed in Changhua County of central Taiwan. Symptomatic plants were collected and examined for the presence of viruses. Electron microscopic examination of ultrathin sections of leaf tissues from the symptomatic orchids found isometric virions of 32 nm in diameter. Subsequently, an isolate (herein designated as ‘92-orchid-1’) with particles of similar size were isolated from one symptomatic orchid and established in Chenopodium quinoa (3). After indirect ELISA tests using antisera against Carnation mottle virus (CarMV), Cucumber mosaic virus, Cymbidium ringspot virus, Tomato bushy stunt virus, Capsicum chlorosis virus, Impatiens necrotic spot virus, Tomato spotted wilt virus, Tomato ringspot virus, and Lisianthus necrosis virus, this isolate reacted positively with the antiserum produced against CarMV (1). CarMV-TW-infected and healthy C. quinoa were used as positive and negative controls, respectively. To further characterize this virus, the conserved region of the polymerase gene (ORF1RT) of Carmoviruses was amplified with degenerate primer pairs, FJJ2003-17 (5′-TATATCTCGAGCAA(A/C)TAGGGG(G/T)GCCT) and FJJ2003-18 (5′-TATAGGATCCCC(C/T)A(A/T)(A/G)GC(A/T)GTGTTCA), by reverse transcription (RT)-PCR using the total RNA isolated from the leaves of 92-orchid-1-, CarMV-TW-infected, and healthy C. quinoa (3). The 894-nt ORF1RT conserved region of isolate 92-orchid-1 (GenBank Accession No. HQ117873) shared 97.1, 65.6, 61.7, and 63.5% nucleotide identities and 98.3, 70.2, 66.1, and 64.7% amino acid identities with those of CarMV (X02986), Pelargonium flower break virus (NC_005286), Saguaro cactus virus (NC_001780), and Angelonia flower break virus (NC_007733), respectively. The sequence comparison of the ORF1RT conserved region indicated that 92-orchid-1 was a carmovirus related to CarMV. Sequence analyses of the coat protein (CP) gene (GenBank Accession No. HQ117872) amplified with the specific CP primer pairs of CarMV (FJJ2004-53: 5′-ACTGCGCTCGAGCTACTCTGTTGACAGTTCTA, and 2004-54: 5′-ATATATGGATCCCGTCCCGCCGTGTGTGTCTA) showed the isolate shared 95.8 to 98.8% nucleotide identities and 96.8 to 98.9% amino acid identities with those of 40 CarMV isolates. Furthermore, the CP gene shared 96.9, 97.0, and 98.8% nucleotide identities and 98.0, 95.7, and 98.3% amino acid identities with isolates from carnation (GenBank Accession No. AY383566) (1), calla lily (GenBank Accession No. HQ117870) (2), and lisianthus (GenBank Accession No. FJ843021), respectively, in Taiwan. These results suggested that this isolate was CarMV but distinct from the above-mentioned three isolates and designated CarMV-Ph. From 2004 to 2007, a further survey of 280 symptomatic Phalaenopsis plants by ELISA using CarMV polyclonal antibodies (1) found that approximately 4% of those tested were infected. To our knowledge, this is the first report of CarMV in Phalaenopsis orchids and the occurrence has substantial implications for the important nursery and floral industry in Taiwan. References: (1) C. C. Chen et al. Plant Pathol. Bull. 12:199, 2003. (2) C. C. Chen et al. Plant Dis. 87:1539, 2003. (3) Y. X. Zheng et al. Eur. J. Plant Pathol. 121:87, 2008.

scholarly journals First Report of Bidens mottle virus Infecting Calendula in Taiwan

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 362-362 ◽  
Author(s):  
C.-H. Huang ◽  
F.-J. Jan
Keyword(s):  
Amino Acid ◽  
Inclusion Bodies ◽  
Amino Acid Identity ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Acid Identity ◽  
First Report ◽  
Cp Gene ◽  
Dna Fragment

In March of 2010, calendula (Calendula officinalis L.), a perennial herb known as the pot marigold, showing chlorotic spots on leaves, chlorosis, and stunting were collected from Puli Township, Nantou County, Taiwan. The disorder occurred in more than 50% of the calendula plants in the field. A virus culture isolated from one of the symptomatic calendulas was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwCa1. With transmission electron microscopy (TEM), negatively stained flexuous filamentous virions approximately 12 × 720 nm were observed in the crude sap of TwCa1-infected C. quinoa leaves and pinwheel inclusion bodies were found in the infected cells. On the basis of the sizes of the viral particles and inclusion bodies, isolate TwCa1 was a suspected potyvirus. By reverse transcription (RT)-PCR and potyvirus degenerate primers (Hrp5/Pot1) (1,2), a 0.65-kb DNA fragment, which included the 3′-end of the NIb gene and the 5′-end of coat protein (CP) gene of the virus, was amplified from total RNA isolated from TwCa1-infected plants. The amplified DNA fragment was cloned and sequenced. A homology search indicated that the new calendula-infecting virus in Taiwan might belong to Bidens mottle virus (BiMoV) because its partial genomic sequence shared 94.9 to 97.3% nucleotide and 96.6 to 98.1% amino acid identity with 11 BiMoV isolates available in NCBI GenBank. Primer pairs Hrp5/oligo d(T) were used to amplify the 3′-end genome of BioMV TwCa1 including the 3′-end of the NIb gene, the full-length CP gene, and the 3′-nontranslatable region of the virus. The 807-nt CP gene of TwCa1 (Accession No. HQ117871) shared 97.3 to 98.6% nucleotide and 98.5 to 98.9% amino acid identity with those of 11 BiMoV isolates available in GenBank. Results from TEM observations and CP gene sequence analysis indicated that TwCa1 is an isolate of BiMoV. BiMoV was later detected by RT-PCR in eight symptomatic calendulas collected from the same field. To our knowledge, this is the first report of BiMoV infecting calendula in Taiwan. This newly identified calendula-infecting BiMoV could have a direct impact on the economically important vegetable and floral industry in Taiwan. References: (1) C. C. Chen et al. Bot. Stud. 947:369, 2006. (2) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993.

scholarly journals First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1122-1122 ◽  
Author(s):  
N. Fiore ◽  
A. Zamorano
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Sweet Cherry ◽  
Mottle Virus ◽  
Reference Sequence ◽  
Nucleotide Identity ◽  
Green Ring ◽  
Sequence Identity ◽  
Cp Gene ◽  
Plant Pathol

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

scholarly journals First Report of Pepper veinal mottle virus in Tomato and Pepper in Taiwan

Plant Disease ◽  
2009 ◽  
Vol 93 (1) ◽  
pp. 107-107 ◽  
Author(s):  
Y. H. Cheng ◽  
R. Y. Wang ◽  
C. C. Chen ◽  
C. A. Chang ◽  
F.-J. Jan
Keyword(s):  
Amino Acid ◽  
Mosaic Virus ◽  
Polyclonal Antibodies ◽  
Amino Acid Identity ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Acid Identity ◽  
First Report ◽  
Cp Gene ◽  
Pepper Veinal Mottle Virus

In May of 2006, samples from tomato plants (Solanum lycopersicum cv. Known-you 301) exhibiting necrotic symptoms on stems, petioles, and leaves were collected from Chiayi County, Taiwan. Double-antibody sandwich-ELISAs were performed using Cucumber mosaic virus, Tomato mosaic virus, Potato virus Y, Watermelon silver mottle virus, and Chilli veinal mottle virus (ChiVMV) polyclonal antibodies. Three of eight samples reacted with antibodies against ChiVMV but not with the others. Using the potyvirus degenerate primers (Hrp 5/Pot 1) (2), an expected 1.5-kb DNA fragment including the 3′-end of the NIb gene, the complete coat protein (CP) gene, and the 3′-nontranslatable region of the virus was amplified from total RNA isolated from these three samples by reverse transcription (RT)-PCR. A homology search in GenBank indicated that the new tomato-infecting virus in Taiwan belongs to Pepper veinal mottle virus (PVMV) since they shared >90% amino acid identity in the CP gene. A virus culture (Tom1) isolated from one of the diseased tomatoes was then established in Chenopodium quinoa and Nicotiana benthamiana and the CP gene was amplified and sequenced (GenBank Accession No. EU719647). Comparisons of the 807-nt CP gene with those of five PVMV isolates available in GenBank showed 81.5 to 93.1% nucleotide and 90.0 to 97.8% amino acid identity. Tom1 induced irregular necrotic lesions on stems, petioles, and leaves of tomato while inducing only mild mottle symptoms on pepper. Serological cross reaction between ChiVMV and PVMV has been observed previously (1,3) and also found in this study. To differentiate these two potyviruses by RT-PCR, primer pair CPVMVup/dw (5′-TATTC(T/C)TCAGTGTGG(A/T/C)T(T/C)CCACCAT and 5′-(T/C)C(A/T)C(A/T)(A/T/G)(A/T)AA(A/G)CCATAA(A/C)(A/C)ATA(A/G)T(T/C)T) was designed on the basis of the comparison of the CP gene and the 3′-nontranslatable region of the PVMV and ChiVMV. DNA fragments of 171 and 259 bp are expected to be amplified from ChiVMV and PVMV, respectively, by RT-PCR with primers CPVMVup/dw. In a field survey done in 2006, samples from diseased peppers (Capsicum annuum) that reacted with the polyclonal antibodies against ChiVMV were further identified by RT-PCR with primers CPVMVup/dw, indicating that both ChiVMV and PVMV infected pepper crops (Capsicum spp.) in Taiwan. A pepper isolate (Pep1) of PVMV was obtained from Nantou County through three times of single lesion passages on C. quinoa and then propagated on N. benthamiana. The CP gene of Pep1 was amplified and sequenced (GenBank Accession No. EU719646) and found to share 99.1% nucleotide and 100% amino acid identity with that of Tom1. Pep1 caused mild mottle symptoms on leaves of both tomato and pepper. To our knowledge, this is the first report of the presence of PVMV in Taiwan as well as in East Asia. References: (1) B. Moury et al. Phytopathology 95:227, 2005. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

scholarly journals First Report of Carnation mottle virus in Calla lily (Zantedeschia spp.)

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1539-1539 ◽  
Author(s):  
C.-C. Chen ◽  
W.-F. Ko ◽  
C.-Y. Lin ◽  
F.-J. Jan ◽  
H. T. Hsu
Keyword(s):  
Mosaic Virus ◽  
Polyacrylamide Gel Electrophoresis ◽  
Dianthus Caryophyllus ◽  
Spherical Particles ◽  
Mottle Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Infected Leaf ◽  
First Report ◽  
Cp Gene ◽  
Carnation Mottle Virus

Calla lilies are ornamental plants of major economic importance in Taiwan. They are grown in the central and northern areas of the island, and ≈3 million stems are shipped annually. Calla lilies are susceptible to several viruses (1). Infections by Cucumber mosaic virus, Dasheen mosaic virus, Turnip mosaic virus, and Watermelon silver mottle virus were reported in Taiwan. Recently, virus-like symptoms including yellow mottling, light yellow spot, yellow ringspot, and mosaic were observed on leaves of field-grown calla lilies from Changhua County, located in central Taiwan. In March 2001, a virus culture was isolated from diseased calla lilies and established in Chenopodium quinoa Willd. and Nicotiana benthamiana Domin. When inoculated with the virus, healthy calla lilies developed chlorotic spots that enlarged and fused to form large, yellow patches on inoculated leaves. Symptoms were similar to those on the naturally infected plants observed in the fields. The virus induced chlorotic local lesions on C. quinoa, C. ficifolium Sm., C. amaranticolor Coste & Reyn, Cucurbita moschata Duchesne ex Poir, Lisianthus russellianum (Don.) Griseb, Phaseolus angularis Wight, Vigna angularis Willd., and V. radiata (L.) Wilczek. In addition to the localized chlorotic spots on inoculated leaves, systemic invasion of the virus was also observed 8 to 10 days postinoculation in Dianthus caryophyllus L., D. chinensis L., and Glycine max Merr. In N. benthamiana, the only symptom observed was systemic wilting. Examination of 2% of uranyl-acetate-stained samples using electron microscopy revealed the presence of spherical particles ≈34 to 35 nm in diameter in crude extracts of leaves of diseased calla lilies, or infected C. quinoa. Similar particles were also observed in the cytoplasm but not in the nuclei in ultrathin sections of virus-infected leaf tissues of C. quinoa and N. benthamiana. Differential centrifugation followed by sucrose density gradient centrifugation of tissue extracts of infected C. quinoa yielded virions with similar size. Sodium dodesyl sulfate polyacrylamide gel electrophoresis of the purified virus showed a single structural polypeptide ith a Mr of 41.6 kDa. The viral antigen reacted positively with its homologous antiserum and an antiserum against Carnation mottle virus (CarMV; Agdia, Inc., Elkhart, IN) in double antibody sandwich enzyme-linked immunosorbent assay. Using primers 5′-CTCCATGGTCATGGAA(A/G)ATAAA GGAGAA and 3′-CAACAAATATCCTACACTGTCCTAGGTG specific to the coat protein (CP) gene of CarMV, an expected viral CP gene product of 1.05 kb was amplified by reverse transcription-polymerase chain reaction from total RNA isolated from infected N. benthamiana. Comparisons of the 1,047-nucleotide CP gene with those of 15 CarMV isolates available in GenBank showed 94.6 to 98.2% nucleotide identity and 94.8 to 96.8% amino acid identity. Results from current studies indicate that the virus infecting calla lilies is an isolate of CarMV. To our knowledge, this is the first report of CarMV infection in calla lilies. The occurrence of CarMV in calla lilies has direct implication for the economically important nursery and floral industry in Taiwan. Reference: (1) F. W. Zettler and R. D. Hartman. Dieffenbachia, Caladium, and Zantedeschia. Pages 464–470 in: Virus and Virus-Like Diseases of Bulb and Flower Crops. G. Loebenstein, R. H. Lawson, and A. A. Brunt, eds. John Wiley and Sons, West Sussex, U.K., 1995.

scholarly journals First Report of Raspberry bushy dwarf virus in Rubus multibracteatus from China

Plant Disease ◽  
2003 ◽  
Vol 87 (5) ◽  
pp. 603-603 ◽  
Author(s):  
C. J. Chamberlain ◽  
J. Kraus ◽  
P. D. Kohnen ◽  
C. E. Finn ◽  
R. R. Martin
Keyword(s):  
Amino Acid ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Dwarf Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Black Raspberry ◽  
First Report ◽  
Raspberry Bushy Dwarf Virus ◽  
Plant Pathol

Raspberry bushy dwarf virus (RBDV), genus Idaeovirus, has been reported in commercial Rubus spp. from North and South America, Europe, Australia, New Zealand, and South Africa. Infection can cause reduced vigor and drupelet abortion leading to crumbly fruit and reduced yields (3,4). In recent years, Rubus germplasm in the form of seed, was obtained on several collection trips to The People's Republic of China to increase the diversity of Rubus spp. in the USDA-ARS National Clonal Germplasm Repository, (Corvallis, OR). Before planting in the field, seedlings were tested for the presence of RBDV, Tomato ringspot virus, and Tobacco streak virus using triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) (antiserum produced by R. R. Martin). One symptomless plant of R. multibracteatus H. Lev. & Vaniot (PI 618457 in USDA-ARS GRIN database), from Guizhou province in China, tested positive for RBDV (RBDV-China). After mechanical transmission on Chenopodium quinoa Willd., this isolate produced typical symptoms of RBDV (3). To determine if RBDV-China was a contaminant during the handling of the plants, or if the source was a seedborne virus, the coat protein gene was sequenced and compared to published sequences of RBDV. RNA was extracted from leaves of R. multibracteatus and subjected to reverse transcription-polymerase chain reaction (RT-PCR) using primers that flank the coat protein gene. Products from four separate PCR reactions were sequenced directly or were cloned into the plasmid vector pCR 2.1 (Invitrogen, Carlsbad, CA) and then sequenced. The coding sequence of the coat protein gene of RBDV-China was 87.5% (722/825) identical to that isolated from black raspberry (Genbank Accession No. s55890). The predicted amino acid sequences were 91.6% (251/274) identical. Previously, a maximum of five amino acid differences had been observed in the coat proteins of different RBDV strains (1). The 23 differences observed between RBDV-China and the isolate from black raspberry (s55890) confirm that the RBDV in R. multibracteatus is not a greenhouse contaminant but is indeed a unique strain of RBDV. In addition, monoclonal antibodies (MAbs) to RBDV (2) were tested against RBDV-China. In these tests, MAb D1 did not detect RBDV-China, whereas MAb R2 and R5 were able to detect the strain. This is the first strain of RBDV that has been clearly differentiated by MAbs using standard TAS-ELISA tests. Although RBDV is common in commercial Rubus spp. worldwide, to our knowledge, this is the first report of RBDV in R. multibracteatus, and the first report of RBDV from China. The effects of this new strain of RBDV could be more or less severe, or have a different host range than previously studied strains. It is more divergent from the type isolate than any other strain that has been studied to date. Phylogenetic analysis of coat protein genes of RBDV may be useful in understanding the evolution and spread of this virus. References: (1) A. T. Jones et al. Eur. J. Plant Pathol. 106:623, 2000. (2) R. R. Martin. Can. J. Plant. Pathol. 6:264, 1984. (3) A. F. Murant. Raspberry Bushy Dwarf. Page 229 in: Virus Diseases of Small Fruits. R. H. Converse, ed. U.S. Dep. Agric. Agric. Handb. 631, 1987. (4) B. Strik and R. R. Martin. Plant Dis. 87:294, 2003.

scholarly journals First Report of Cymbidium mosaic virus and Odontoglossum ringspot virus in Orchids in Mexico

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 464-464
Author(s):  
A. G. Soto-Valladares ◽  
R. De La Torre-Almaraz ◽  
B. Xoconostle-Cazares ◽  
R. Ruíz-Medrano
Keyword(s):  
Mosaic Virus ◽  
Pcr Amplification ◽  
Positive Sample ◽  
Ringspot Virus ◽  
Rdrp Gene ◽  
Mixed Infections ◽  
Cymbidium Mosaic Virus ◽  
First Report ◽  
Odontoglossum Ringspot Virus ◽  
Cp Gene

In 2010, a survey for viral diseases in commercial, orchid-producing greenhouses was carried out in Morelos, Mexico. Many symptomatic plants were observed. The most common leaf symptoms were yellow mottle, yellow streaks, and chlorotic and necrotic ringspots. Leaf samples were collected from eight symptomatic plants from the following genera: Encyclia, Oncidium, Shomburghia, Brassia, Guarianthe, Cattleya, Epidendrum, Vanilla, Xilobium, Laelia, and Brassocattleya. Samples were tested using double-antibody sandwich (DAS)-ELISA (Agdia, Elkhart, IN) with antiserum for Cymbidium mosaic virus (CymMV), Odontoglossum ringspot virus (ORSV), Cymbidium ringspot mosaic virus, and Tobacco mosaic virus (TMV) and a general antiserum for potyviruses. At least one plant from each genus was positive to CymMV and ORSV as individual or mixed infections. Encyclia and Laelia plants were the most frequently found with mixed infections by both viruses. All genera were negative for TMV and potyviruses. Total RNA extracts were obtained from all ELISA-positive samples by a modified silica capture protocol (2). Reverse transcription (RT)-PCR was carried out with general polymerase (RdRp) gene primers corresponding to the Potexvirus group (3) and specific primers for the coat protein gene (CP) of CymMV and ORSV (1). The PCR amplification from a positive sample of each genus was resolved in agarose gels. Amplification products of the expected size were obtained for CymMV and ORSV. Five CymMV RdRp gene clones from five different plants of Laelia (GenBank Accession Nos. HQ393958, HQ393959, HQ393960, HQ393961, and HQ393962), two CP gene clones of CP gene of CymMV from two different plants of Oncidium (GenBank Accession Nos. HQ393956 and HQ393957), and three CP clones of CP of ORSV from three different plants of Encyclia (GenBank Accession Nos. HQ393953, HQ393954, and HQ393955) were sequenced. The nucleotide sequences of the Mexican orchid CymMV isolates were 96 to 97% identical to CymMV sequences in the GenBank, while those of ORSV were 99 to 100% identical to deposited ORSV sequences. To our knowledge, this is the first report of CymMV and ORSV in orchids in Mexico, which are two of the most important quarantine virus in orchids in Mexico. References: (1) P. Ajjikuttira et al. J. Gen. Virol. 86:1543, 2005. (2) J. R. Thompson et al. J. Virol. Methods 111:85, 2003. (3) R. A. A. van der Vlugt and M. Berendsen. Eur. J. Plant Pathol. 108:367, 2002.

scholarly journals Engineered Resistance Against Papaya ringspot virus in Venezuelan Transgenic Papayas

Plant Disease ◽  
2004 ◽  
Vol 88 (5) ◽  
pp. 516-522 ◽  
Author(s):  
Gustavo Fermin ◽  
Valentina Inglessis ◽  
Cesar Garboza ◽  
Sairo Rangel ◽  
Manuel Dagert ◽  
...  
Keyword(s):  
Amino Acid ◽  
Agrobacterium Tumefaciens ◽  
Coat Protein ◽  
Amino Acid Sequence ◽  
Sequence Similarity ◽  
Ringspot Virus ◽  
Amino Acid Sequence Similarity ◽  
Papaya Ringspot Virus ◽  
Local Varieties ◽  
Cp Gene

Local varieties of papaya grown in the Andean foothills of Mérida, Venezuela, were transformed independently with the coat protein (CP) gene from two different geographical Papaya ringspot virus (PRSV) isolates, designated VE and LA, via Agrobacterium tumefaciens. The CP genes of both PRSV isolates show 92 and 96% nucleotide and amino acid sequence similarity, respectively. Four PRSV-resistant R0 plants were intercrossed or selfed, and the progenies were tested for resistance against the homologous isolates VE and LA, and the heterologous isolates HA (Hawaii) and TH (Thailand) in greenhouse conditions. Resistance was affected by sequence similarity between the transgenes and the challenge viruses: resistance values were higher for plants challenged with the homologous isolates (92 to 100% similarity) than with the Hawaiian (94% similarity) and, lastly, Thailand isolates (88 to 89% similarity). Our results show that PRSV CP gene effectively protects local varieties of papaya against homologous and heterologous isolates of PRSV.

scholarly journals Comparison of Ambisense M RNA of Watermelon Silver Mottle Virus with Other Tospoviruses

1998 ◽  
Vol 88 (4) ◽  
pp. 351-358 ◽  
Author(s):  
Fang-Hua Chu ◽  
Shyi-Dong Yeh
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Consensus Sequence ◽  
Chenopodium Quinoa ◽  
Distinct Species ◽  
Mottle Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Cdna Clones ◽  
Genomic Rnas ◽  
Watermelon Silver Mottle Virus

Double-stranded genomic RNAs (dsRNAs) extracted from Chenopodium quinoa infected with watermelon silver mottle virus (WSMV) were similar to those of tomato spotted wilt virus (TSWV, serogroup I) and impatiens necrotic spot virus (INSV, serogroup III), except that the S dsRNA of WSMV is 0.75 and 0.6 kbp longer than those of TSWV and INSV, respectively. The complete nucleotide sequence of the genomic M RNA of WSMV was determined from cDNA clones generated from separated M dsRNA. The M RNA is 4,880 nucleotides in length with two open reading frames (ORFs) in an ambisense organization. The M RNA-encoded nonstructural (NSm) ORF located on the viral strand encodes a protein of 312 amino acids (35 kDa), and the G1/G2 ORF located on the viral complementary strand encodes a protein of 1,121 amino acids (127.6 kDa). The RNA probe corresponding to the NSm or G1/G2 ORF of WSMV failed to hybridize with the M dsRNAs of TSWV and INSV. Comparison of M and S RNAs of WSMV, TSWV, INSV, and peanut bud necrosis virus (PBNV, serogroup IV) revealed a consensus sequence of eight nucleotides of 5′-AGAGCAAU…-3′ at their 5′ ends and 5′-…AUUGCUCU-3′ at their 3′ ends. The low overall nucleotide identities (56.4 to 56.9%) of the M RNA and the low amino acid identities of the NSm and G1/G2 proteins (30.5 to 40.9%) with those of TSWV and INSV indicate that WSMV belongs to the Tospovirus genus but is phylogenetically distinct from viruses in serogroups I and III. The M RNA of WSMV shares a nucleotide identity of 79.6% with that of PBNV, and the two viruses share 83.4 and 88.7% amino acid identities for their NSm and G1/G2 proteins, respectively. It is concluded that they are two related but distinct species of serogroup IV. In addition to the viral or viral complementary full-length M RNA, two putative RNA messages for the NSm gene and the G1/G2 gene, 1.0 and 3.4 kb, respectively, were detected from the total RNA extracted from WSMV-infected tissue of Nicotiana benthamiana. The 1.0- and 3.4-kb RNAs were also detected in the viral RNAs extracted from purified nucleocapsids, suggesting that the putative messages of the M RNA of WSMV can also be encapsidated by the nucleocapsid protein.

scholarly journals Comparação da seqüência de nucleotídeos do gene da proteína capsidial de estirpes severas e premunizantes do Papaya ringspot virus

2003 ◽  
Vol 28 (6) ◽  
pp. 678-681 ◽  
Author(s):  
Marilia G. S. Della Vecchia ◽  
Luis E. A. Camargo ◽  
Jorge A. M. Rezende
Keyword(s):  
Amino Acids ◽  
Amino Acid ◽  
Core Region ◽  
Amino Acid Sequences ◽  
Ringspot Virus ◽  
Papaya Ringspot Virus ◽  
Specific Primers ◽  
Sequence Comparisons ◽  
The Core ◽  
Cp Gene

This study compared three mild and three severe strains of Papaya ringspot virus - type W (PRSV-W), based on nucleotide and amino acid sequences of the capsid protein (CP) gene. The CP nucleotide sequences of the mild strains shared 98% to 100% identity. When compared to the severe strains the identity ranged from 93% to 95%, except in the case of PRSV-W-2R, which resulted from reversion of the mild strains PRSV-W-2. The CP sequence of the reverting strain showed 100% identity with the sequence of its parental strain. An insertion of six nucleotides in the core region of the CP gene, which reflected the addition of two amino acids (Asn and Asp) in the deduced sequence of the protein, was found in all mild strains. These sequence comparisons were used to design strain-specific primers that were used to specifically amplify regions for either the mild or severe strains.

Sign in / Sign up

Export Citation Format

Share Document