First Record of Colletotrichum gloeosporioides Causing Anthracnose of Banana in Pakistan

Plant Disease ◽  
2021 ◽  
Author(s):  
Muhammad Waqar Alam ◽  
Arif Malik ◽  
Abdul Rehman ◽  
Akhtar Hameed ◽  
Mubeen Sarwar ◽  
...  
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Its Region ◽  
First Record ◽  
Morphological Characterization ◽  
Pathogenicity Test ◽  
Banana Fruit ◽  
Sterile Water ◽  
Single Spore ◽  
Sterile Needle ◽  
Multiple Sequences

Banana (Musa spp.) is one of the most widely grown and consumed fruits in Pakistan and all around the world due to their distinct aroma and taste. In 2018, anthracnose symptoms were observed on banana fruit harvested from different plantations of Sindh- a major banana producing Province of Pakistan. Approximately, 25% of banana fruit collected from different plantations were infected. The symptoms consisted of small brown to reddish-brown spots on the fruit surface and then became sunken lesions as the disease progressed. To identify the pathogen, infected tissues (5 mm in diameter) from the margin of the lesions were surface sterilized by dipping in 1% sodium hypochlorite (NaOCl) for 2 min, 70% ethanol for 30 s, and then rinsed twice with sterile distilled water, plated onto potato dextrose agar (PDA), and incubated at 27°C for 5 days with 12 h light and darkness cycle. Colonies with a similar pattern were consistently isolated and all colonies were sub-cultured using the single-spore method. Colonies first appeared with white colored mycelium and later turned to dark gray. Conidia produced in acervuli were cylindric, hyaline, straight, and aseptate, with both ends rounded. Conidia measured 14.0 ± 0.5 × 3.4 ± 0.6 μm. Conidiomata were dark brown and spherical. On the basis of morphological characterization, the pathogen was identified as Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. (Weir et al. 2012). Two independent isolates (PDL2031 and PDL2032) were used for further genetic analysis. The internal transcribed spacer (ITS) region and chitin synthase 1 (CHS-1) gene were amplified from genomic DNA using primer pairs of ITS1/ITS4 and CHS-79F/CHS-345R, respectively (White et al. 1990; Damm et al. 2012). The GenBank accession numbers (MW493198, MW504711 for ITS and MW530421, MW530422 for CHS-1) of the sequences exhibited 99% to 100% identity to multiple sequences of C. gloeosporioides. To conduct a pathogenicity test, 10 healthy fruits were selected and surface sterilized with 70% ethanol followed by a wash of sterilized water. The fruits were stabbed with a sterile needle and a drop of 20 µl of spore suspension (106 spores/ml) was placed on each wound independently. Meanwhile 10 fruits inoculated with sterile water were treated as controls. The fruits were incubated at 27°C with 90% relative humidity for 10 days. Inoculated fruits exhibited symptoms similar to the original infection. No visible lesions appeared on control fruit. C. gloeosporioides was successfully reisolated from the inoculated fruit, confirming Koch’s postulates. Anthracnose of banana is known to be caused by C. musae, C. gloeosporioides, C. siamense, C. tropicale, C. chrysophilum, C. theobromicola, and C. scovillei (Kumar et al. 2017; Peres et al. 2001; Vieira et al. 2017; Zakaria et al. 2009; Zhou et al. 2017). To our knowledge, this is first report of anthracnose of banana caused by C. gloeosporioides in Pakistan. The new disease primarily reduces the quality and yield of Banana. Effective measures should be taken to manage this disease.

scholarly journals First Report of Colletotrichum siamense Causing Anthracnose of Monstera deliciosa in Zhanjiang, China

Plant Disease ◽  
2020 ◽  
Author(s):  
Yue Lian Liu ◽  
Jian Rong Tang ◽  
Yu Han Zhou
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Pathogenicity Test ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Rdna Its ◽  
Colletotrichum Siamense ◽  
Monstera Deliciosa ◽  
Pure Cultures

Monstera deliciosa Liebm is an ornamental foliage plant (Zhen et al. 2020De Lojo and De Benedetto 2014). In July of 2019, anthracnose lesions were observed on leaves of M. deliciosa cv. Duokong with 20% disease incidence of 100 plants at Guangdong Ocean University campus (21.17N,110.18E), Guangdong Province, China. Initially affected leaves showed chlorotic spots, which coalesced into larger irregular or circular lesions. The centers of spots were gray with a brown border surrounded by a yellow halo (Supplementary figure 1). Twenty diseased leaves were collected for pathogen isolation. Margins of diseased tissue was cut into 2 × 2 mm pieces, surface-disinfected with 75% ethanol for 30 s and 2% sodium hypochlorite (NaOCl) for 60 s, rinsed three times with sterile water before isolation. Potato dextrose agar (PDA) was used to culture pathogens at 28℃ in dark. Successively, pure cultures were obtained by transferring hyphal tips to new PDA plates. Fourteen isolates were obtained from 20 leaves. Three single-spore isolates (PSC-1, PSC-2, and PSC-3) were obtained ,obtained, which were identical in morphology and molecular analysis (ITS). Therefore, the representative isolate PSC-1 was used for further study. The culture of isolate PSC-1 on PDA was initially white and later became cottony, light gray in 4 days, at 28 °C. Conidia were single celled, hyaline, cylindrical, clavate, and measured 13.2 to 18.3 µm × 3.3 to 6.5 µm (n = 30). Appressoria were elliptical or subglobose, dark brown, and ranged from 6.3 to 9.5 µm × 5.7 to 6.5 µm (n = 30). Morphological characteristics of isolate PSC-1 were consistent with the description of Colletotrichum siamense (Prihastuti et al. 2009; Sharma et al. 2013). DNA of the isolate PSC-1 was extracted for PCR sequencing using primers for the rDNA ITS (ITS1/ITS4), GAPDH (GDF1/GDR1), ACT (ACT-512F/ACT-783R), CAL (CL1C/CL2C), and TUB2 (βT2a/βT2b) (Weir et al. 2012). Analysis of the ITS (accession no. MN243535), GAPDH (MN243538), ACT (MN512640), CAL (MT163731), and TUB2 (MN512643) sequences revealed a 97-100% identity with the corresponding ITS (JX010161), GAPDH (JX010002), ACT (FJ907423), CAL (JX009714) and TUB2 (KP703502) sequences of C. siamense in GenBank. A phylogenetic tree was generated based on the concatenated sequences of ITS, GAPDH, ACT, CAL, and TUB2 which clustered the isolate PSC-1 with C. siamense the type strain ICMP 18578 (Supplementary figure 2). Based on morphological characteristics and phylogenetic analysis, the isolate PSC-1 associated with anthracnose of M. deliciosa was identified as C. siamense. Pathogenicity test was performed in a greenhouse at 24 to 30oC with 80% relative humidity. Ten healthy plants of cv. Duokong (3-month-old) were grown in pots with one plant in each pot. Five plants were inoculated by spraying a spore suspension (105 spores ml-1) of the isolate PSC-1 onto leaves until runoff, and five plants were sprayed with sterile water as controls. The test was conducted three times. Anthracnose lesions as earlier were observed on the leaves after two weeks, whereas control plants remained symptomless. The pathogen re-isolated from all inoculated leaves was identical to the isolate PSC-1 by morphology and ITS analysis, but not from control plants. C. gloeosporioides has been reported to cause anthracnose of M. deliciosa (Katakam, et al. 2017). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa in ChinaC. siamense causes anthracnose on a variety of plant hosts, but not including M. deliciosa (Yanan, et al. 2019). To the best of our knowledge, this is the first report of C. siamense causing anthracnose on M. deliciosa, which provides a basis for focusing on the management of the disease in future.

scholarly journals Brown Culm Rot of Dendrocalamus latiflorus Munro Caused by Diaporthe guangxiensis in Sichuan Province, China

Plant Disease ◽  
2021 ◽  
Author(s):  
Wenjian Wei ◽  
Han Zhang ◽  
Liling Xie ◽  
Han Liu ◽  
Fengying Luo ◽  
...  
Keyword(s):  
Genomic Dna ◽  
Southern China ◽  
Disease Incidence ◽  
Its Region ◽  
Sichuan Province ◽  
Control Measures ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Single Spore ◽  
Dendrocalamus Latiflorus

Dendrocalamus latiflorus Munro, the most widely cultivated bamboo species in southern China, has high ornamental value used in gardens, while culms are also used for buildings and as fibers and edibles (Gao et al. 2011). In June 2020, brown culm rot of bamboo was observed in Yibin city, Sichuan Province, in an area of approximately 1000 hectares. Disease incidence was approximately 60%, of which 30% of the plants had died. At the end of June, the lesions expanded but did not surround the base of the culm. From the end of June to the beginning of September, the lesions expanded upward and formed a streak, of which the color gradually deepened to purple-brown and black-brown. At the same time, the disease spots at the base of the culm also expanded horizontally. After the spots surrounded the base of the culm, the diseased bamboo died. Ten culms showing typical symptoms were collected and cut into 5×5 mm pieces at the junction of infected and healthy tissues. The tissues were sterilized for 1 to 2 min in 3% sodium hypochlorite, decontaminated in 75% alcohol for 3 to 5 min, placed on modified potato glucose agar (PDA) with streptomycin sulfate (50 μg/ml), and incubated at 26°C. Two isolates were obtained by the single-spore method (Sivan et al. 1992). The isolates both produced white round colonies similar to Diaporthe guangxiensis and two types of conidia: one was α type (5.5 to 8.2×1.0 to 2.8 µm, n=30), colourless, single-celled, undivided, and oval, containing two oil droplets; and β type (21.1 to 30.2×0.8 to 1.4 µm, n=30), colourless, single celled and hook shaped. Genomic DNA was extracted from the two isolates by using a fungal genomic DNA extraction kit (Solarbio, Beijing). The products were amplified by polymerase chain reaction (PCR) with primers for the internal transcribed spacer 1 (ITS) region (White et al. 1990), calmodulin (CAL) gene (Carbone and Kohn 1999), translation elongation factor 1-alpha (TEF) gene (Glass and Donaldson 1995) and beta-tubulin (TUB) gene (Soares et al. 2018). The amplified products were sequenced and blasted in GenBank (accession numbers MW380383, MW431318, MW431317 and MW431316 for ITS, CAL, TEF, and TUB, respectively). The ITS, CAL, TEF, and TUB sequences showed 100%, 99.33%, 100%, and 99.80% identity to D. guangxiensis JZB320094 (accession numbers MK335772.1, MK736727.1, MK523566.1, MK500168.1 in GenBank), respectively. To evaluate the pathogenicity of the isolates, five plants were each inoculated with two isolates. The cortex of potted bamboo were injured locally with sterilized needle, and the bamboo culms were inoculated with 100 μl of conidial suspension (105 cfu/ml). The surface of the inoculation wound was covered with gauze soaked with sterilized water. Five plants inoculated with sterile water were used as controls. The treated plants were maintained in a greenhouse at a temperature of 22 to 29°C and relative humidity of 70 to 80%. One month later, of all inoculated plants showed similar symptoms as those observed in the field. D. guangxiensis was re-isolated from all inoculated plants. The pathogenicity test was repeated three times with similar results. This is the first report of D. guangxiensis causing brown culm rot of D. latiflorus in China. These results will facilitate an enhanced understanding of factors affecting bamboo and the design of effective management strategies of the pathogenic species on bamboo and thus to develop corresponding control measures.

scholarly journals First Report of Anthracnose of Tricyrtis macropoda Caused by Colletotrichum gloeosporioides in Korea

Plant Disease ◽  
2012 ◽  
Vol 96 (7) ◽  
pp. 1070-1070 ◽  
Author(s):  
J. H. Park ◽  
K. S. Han ◽  
Y. D. Kwon ◽  
H. D. Shin
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Morphological Characteristics ◽  
Its Region ◽  
Culture Collection ◽  
Perennial Herb ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Natural Habitats ◽  
First Report ◽  
Small Water

Tricyrtis macropoda Miq. (syn. T. dilatata Nakai), known as speckled toadlily, is a perennial herb native to China, Japan, and Korea. The plant has been highly praised for its beautiful flowers and rare populations in natural habitats. In September 2006, several dozen plants were heavily damaged by leaf spots and blight in cultivated plantings in the city of Pocheon, Korea. The infections with the same symptoms were repeated every year. In July 2011, the same symptoms were found on T. macropoda in the cities of Gapyeong and Osan, Korea. The leaf lesions began as small, water-soaked, pale greenish to grayish spots, which enlarged to form concentric rings and ultimately coalesced. A number of blackish acervuli were formed in the lesions. Acervuli were mostly epiphyllous, circular to ellipsoid, and 40 to 200 μm in diameter. Setae were two- to three-septate, dark brown at the base, paler upwards, acicular, and up to 100 μm long. Conidia (n = 30) were long obclavate to oblong-elliptical, sometimes fusiform-elliptical, guttulate, hyaline, and 12 to 20 × 4 to 6.5 μm (mean 15.4 × 5.2 μm). These morphological characteristics of the fungus were consistent with the description of Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. (2). Voucher specimens (n = 7) were deposited in the Korea University herbarium (KUS). Two isolates, KACC46374 (ex KUS-F25916) and KACC46405 (ex KUS-F26063), were deposited in the Korean Agricultural Culture Collection. Fungal DNA was extracted and the complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting sequences of 549 bp were deposited in Genbank (Accession Nos. JQ619480 and JQ619481). They showed 100% similarity with a sequence of C. gloeosporioides (EU32619). Isolate KACC46374 was used in a pathogenicity test. Inoculum was prepared by harvesting conidia from 3-week-old cultures on potato dextrose agar. A conidial suspension (2 × 106 conidia/ml) was sprayed onto 15 leaves of three plants. Three noninoculated plants served as controls. Plants were covered with plastic bags to maintain 100% relative humidity for 24 h and then kept in a greenhouse (22 to 28°C and 70 to 80% RH). After 5 days, typical leaf spot symptoms, identical to the ones observed in the field, started to develop on the leaves of inoculated plants. No symptoms were observed on control plants. C. gloeosporioides was reisolated from the lesions of inoculated plants, thus fulfilling Koch's postulates. An anthracnose associated with C. tricyrtii (Teng) Teng was recorded on T. formosana and T. latifolia in China (3) and on T. formosana in Taiwan (1), respectively, without etiological studies. The morphological features of C. tricyrtii are within the variation of C. gloeosporioides (2). To our knowledge, this is the first report of anthracnose of T. macropoda. This report has significance to indigenous plant resource conservation managers and scientists because T. macropoda has been listed as one of the 126 “Rare and Endangered Plants” by the Korea Forest Service since 1991. References: (1) K. Sawada. Rep. Dept. Agric. Gov. Res. Inst. Formosa 87: 1, 1944. (2) B. C. Sutton. Pages 1–27 in: Colletotrichum Biology, Pathology and Control. J. A. Bailey and M. J. Jeger, eds. CAB International, Wallingford, U.K. 1992. (3) S. C. Teng. Contrib. Biol. Lab. Sci. Soc. China 8:36, 1932.

scholarly journals Valdensinia heterodoxa Peyronel as a New Pathogen of Blueberry in Poland

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 688-688
Author(s):  
R. Dzięcioł ◽  
E. Mirzwa-Mróz ◽  
E. Zielińska ◽  
M. Wińska-Krysiak ◽  
W. Wakuliński
Keyword(s):  
Soil Surface ◽  
Its Region ◽  
Vaccinium Corymbosum ◽  
Leaf Blight ◽  
Single Spore ◽  
Initial Symptoms ◽  
Sterile Needle ◽  
Young Leaves ◽  
Necrotic Spots ◽  
Thermal Cycler

Valdensia leaf blight on blueberry in Poland was reported in one commercial nursery plantation near Prażmów, Mazovia voivodship, where heavy defoliation was observed on cv. Bluecrop, grown in nursery pots, in August 2011. Older fruiting bushes were only slightly affected by the disease. Initial symptoms of the disease were small, oval to circular zonated necrosis surrounded with dark brown borders that enlarged on the leaves throughout the canopy. Multicellular, hyaline or light brown, star-shaped conidiospores were observed on the necrotic areas. The mean length of 50 conidiospores from the end of head to the end of arm apex was 307 to 348 μm (4). Eight single-spore isolates of the fungus were obtained. Single conidiospores were picked up from necrotic spots on leaves and transferred with sterile needle on potato dextrose agar (PDA) and incubated at 20°C under ambient light. After 10 days of incubation, total DNA was extracted. Amplification of the internal transcribed spacer (ITS) region of rDNA was done using primers ITS1F and ITS4A (1). PCRs were carried out as follows: initial denaturation at 94°C for 2 min, denaturation at 94°C for 1 min, annealing at 57°C for 1 min, extension at 72°C for 1 min, and final extension at 72°C for 5 min for 28 cycles (Applied Biosystems Veriti 96 Wel Thermal Cycler). Amplicons, which were approximately 520 bp, were sequenced and nucleotide sequences were analyzed by Clustal W2EBI. The sequences of all eight isolates showed 100% similarity to each other and were compared with sequences stored in GenBank using BLAST. Sequences were 525 bp long and showed 100% homology to Valdensinia heterodoxa Peyronel, Sclerotiniaceae (anamorph: Valdensia heterodoxa Peyronel) from Japan and Norway (Accession Nos. AB663682 and Z81447, respectively) (3). The sequence from one isolate was submitted to GenBank (Accession No. KF212190). To fulfill Koch's postulates, each of the eight isolates was used to inoculate 20 healthy young leaves of Vaccinium corymbosum L. cv. Bluecrop and bilberry (V. myrtillus L.) (10 leaves per plant). Mycelial plugs 5 mm in diameter were taken from PDA cultures, approximately 20 days old, and used as inoculum and placed in the center of each leaf and moistened with sterile distilled water. Mycelium-free plugs were used as control. Inoculated leaves were placed in plastic box and incubated at 20°C in laboratory for 5 days, at which time small necrotic lesions consistent with initial symptoms of the disease were observed. Isolates obtained from these symptoms were morphologically identical to those used for inoculation. Control leaves did not show any disease symptoms. Valdensia leaf blight occurrence may be attributed to rainy July and August 2011 and long presence of water on soil surface. In Poland, Valdensinia heterodoxa causes heavy defoliation of Vaccinium myrtillus in pine stands and is a common pathogen of some herbaceous plants (2). To our knowledge, this is the first report of Valdensia leaf blight on highbush blueberry in Poland. References: (1) I. Larena et al. 75:187, 1999. (2) W. Mułenko and S. Woodward. Mycologist 10:69, 1996. (3) S. Nekoduka et al. J. Gen. Plant Pathol. 78:151, 2012. (4) S. Zhao and S. F. Shamoun. Mycology 1:113, 2010.

scholarly journals First Report of Black Rot Caused by Phomopsis cucurbitae on Cantaloupe (Cucumis melo) in the Piedmont Region of Northern Italy

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1317-1317
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
A. Poli ◽  
M. L. Gullino
Keyword(s):  
Cucumis Melo ◽  
Morphological Characteristics ◽  
Its Region ◽  
Northern Italy ◽  
Pathogenicity Test ◽  
First Report ◽  
Sterile Needle ◽  
Pathogenicity Tests ◽  
Cucumis Melo L ◽  
Piedmont Region

Cucumis melo L., belonging to the Cucurbitaceae family, is cultivated on more than 23,000 ha in Italy. Cantaloupe (C. melo L. var. cantalupensis Naudin) is the most popular variety. In summer 2010, a previously unknown rot was observed on fruits produced in Italy and marketed in the Piedmont Region of northern Italy. Early symptoms on fruit consisted of irregular, brown, soft, sunken lesions up to 10 cm in diameter. No surface mold was visible and pycnidia were not present. Internally, the decay is adjacent to the sunken area of the fruit's surface and is soft, water soaked, spongy, with a nearly circular margin, and easily separated from healthy tissues. Fragments (approximately 3 mm3) were taken from the margin of the internal diseased tissues, cultured on potato dextrose agar (PDA), and incubated at 24 ± 1°C, (16 h of light and 8 h of darkness). Fungal colonies initially appeared coarse, at first whitish then buff brown, and produced dark pycnidia 0.5 mm in diameter, which exuded numerous conidia belonging to two types. Type A conidia were hyaline, unicellular, ellipsoidal to fusiform, sometimes slightly constricted in the middle, and measured 5.6 to 10.3 × 1.7 to 2.6 (average 8.0 × 2.1) μm. Type B conidia were hyaline, long, slender, curved, and measured 17.1 to 26.6 × 0.7 to 1.4 (average 22.0 × 1.0) μm. Sclerotia were not produced. The morphological characteristics of the fungus corresponded to those of the genus Phomopsis (1). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLAST analysis of the 543-bp segment showed a 99% similarity with the sequence of a Phomopsis sp. (GenBank Accession No. HM999947). The nucleotide sequence has been assigned the GenBank Accession No. JN032733. Both Phomopsis cucurbitae and P. sclerotioides are pathogenic to Cucurbitaceae, however P. cucurbitae is identifiable by the production of B conidia and the absence of sclerotia. Therefore, P. cucurbitae has been considered the causal agent of the disease. Pathogenicity tests were performed by inoculating three wounded cantaloupe fruits after surface disinfesting in 1% sodium hypochlorite. Six wounds per fruit, 1 cm deep, were made with a sterile needle. Mycelial disks (10 mm in diameter), obtained from PDA cultures of one strain, were placed on each wound. Three control fruits were inoculated with PDA. Fruits were incubated at 16 ± 1°C in the dark. The first symptoms developed 4 days after the artificial inoculation. Two days later, the rot developed at all inoculation points and the pathogen was consistently reisolated. Noninoculated fruit remained healthy. The pathogenicity test was performed twice with similar results. P. cucurbitae has been reported on melon in many countries (2,3). To our knowledge, this is the first report of the disease in Italy. Currently, the relevance of the disease in the country is not yet well known. However, attention must be paid considering that the pathogen can be transmitted through seeds. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (2) L. Beraha and M. J. O'Brien. Phytopathol. Z. 94:199, 1979. (3) E. Punithalingam and P. Holliday. Phomopsis cucurbitae. IMI Descriptions of Fungi and Bacteria. 47, Sheet 469, 1975.

scholarly journals First Report of Anthracnose on Hymenocallis littoralis Caused by Colletotrichum siamense in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Yong Huang ◽  
Yue Qin zhang ◽  
Han Hu ◽  
Nai Feng
Keyword(s):  
Its Region ◽  
Leaf Spot Disease ◽  
Data Sets ◽  
Conidial Suspension ◽  
Single Spore ◽  
Koch’S Postulates ◽  
First Report ◽  
Medicinal Value ◽  
Sterile Needle ◽  
Koch's Postulates

Spider lily (Hymenocallis littoralis (Jacq.) Salisb.) is a widely cultivated horticultural plant worldwide and has ornamental and medicinal value. Spider lily plants were seriously affected by a leaf spot disease in the campus of Guangdong Ocean University and gardens in Zhanjiang city in February 2018 with an incidence of 30 to 100%. Affected leaves usually developed small circular purple spots, which enlarged to oval spots and large irregular spots. The spots were brown at the center, deep purple at the border and surrounded by a yellow halo. Diseased cultivars were collected in Zhanjiang city, Gangzhou city in Guangdong province and and Zhangping city in Fujian province. Symptomatic leaf samples were disinfested with 1% NaOCl, and cultured on sucrose agar (PSA) at 28 °C for one week. Ten single-spore isolates were recovered from PSA medium. Colonies developing on PSA were grayish white with a regular border. Conidia were straight, hyaline with rounded ends, 4.3 to 6.1×12.8 to 32.1μm (n = 50 conidia of each isolate). Fungal mycelia were hyaline, septate, and branched. Conidia were born on a long conidiogenous cell, appressoria were oval, 6.7 to 10.7 × 5.2 to 6.2 μm (n=50). The isolates were morphologically identified as Colletotrichum sp. (Weir et al. 2012). Tests of pathogenicity were performed according to Koch's postulates using three isolates. Fresh wounds were made with a sterile needle on the healthy surface of leaves of H. littoralis at the 4- to 6-leaf stage and each leaf was covered with a piece of cotton drenched with 200 μL of conidial suspension (106 conidia/ml) from each isolate. Control seedlings were inoculated identically except sterile water was used to drench the cotton. Inoculated plants were placed in a moisturizing light incubator at 25℃ and 80% humidity under a 12-h light/dark cycle for 20 days and examined daily to monitor disease symptom development. Small round brown spots were observed at the inoculation sites 3 days after the inoculation. The brown spots developed into large brown lesions 5 days after inoculation. There were no symptoms observed in the water-inoculated plants. A Colletotrichum spp. strain based on morphology was consistently reisolated from leaves lesions fulfilling Koch’s postulates. For molecular identification, the internal transcribed spacer (ITS) region of ribosomal DNA, calmodulin (CAL), Tublin (Tub) and Apmat loci of three isolates were amplified using primer pairs of ITS4/ITS5, CL1C/CL2C, T1/T2 and AM-F/AM-R (Sharma et al. 2015). A phylogenetic tree derived from a neighbor-joining analysis of a concatenated alignment of ITS, CAL, Tub and ApMAT sequences was created. The accession numbers of three isolates GZHLCG, ZJHLCG and FJHLCG used in this study were MW553083, MN540457, MN540458 for ITS, MW553087- MW553089 for CL, MW553090-MW553092 for Tub and MW553084-MW553086 for ApMAT. The sequences of the three isolates were aligned with related species of Colletotrichum (Sharma et al. 2015). Analyses based on concatenated data sets of four genes showed that the sequences had high levels of identity to those of the C. siamense strains. According to both morphological and sequence analyses, the H. littoralis pathogen was identified as C. siamense. There is a report of foliar diseases on H. littoralis caused by Colletotrichum sp. (Tan et al., 2009). To our knowledge, this is the first report of anthracnose on H. littoralis caused by C. siamense in China. Identification of the pathogen provide valuable information for diagnosis and controlling this disease in H. littoralis.

scholarly journals First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 425-425 ◽  
Author(s):  
M. M. Haque ◽  
P. Martínez-Álvarez ◽  
J. M. Lomba ◽  
J. Martín-García ◽  
J. J. Diez
Keyword(s):  
Aerial Mycelium ◽  
Its Region ◽  
Alnus Glutinosa ◽  
First Record ◽  
Pathogenicity Test ◽  
Soil Extracts ◽  
Collar Rot ◽  
Plant Pathol ◽  
Extent Of Damage ◽  
Potential Interactions

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36′34″ N, 3°25′10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41′42″ N, 5°35′36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d–1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5′ GAAGGTGAAGTCGTAACAAGG 3′) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.

scholarly journals First Report of Leaf Spot on Tibouchina semidecandra Caused by Beltrania rhombica in China

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1380-1380 ◽  
Author(s):  
Z. R. Shi ◽  
M. M. Xiang ◽  
Y. X. Zhang ◽  
J. H. Huang
Keyword(s):  
Leaf Spot ◽  
Its Region ◽  
Control Measures ◽  
Control Treatment ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Potted Plants ◽  
Detached Leaves

Tibouchina semidecandra Cogn. is a popular ornamental plant in tropical and subtropical areas (1). In August 2011, a leaf spot was observed on approximately 70% of 5,000 potted plants of T. semidecandra in a nursery in Zhongshan, Guangdong Province, China. Each leaf spot was round with a brown center surrounded by a reddish brown border, and ranged from 8 to 10 mm in diameter. A fungus was isolated consistently from the lesions by surface-sterilizing symptomatic leaf sections (each 3 cm2) with 75% alcohol for 8 s, washing the sections with sterile water, soaking the sections in 3% NaOCl for 15 s, rinsing the sections with sterile water three times, and then placing the sections on potato dextrose agar (PDA) at 28°C. Each of three single-spore isolates on PDA produced gray, floccose colonies that reached 70 mm in diameter after 5 days at 28°C. Setae were dark brown, straight, erect, distantly and inconspicuously septate, and 125 to 193 × 3.0 to 4.5 μm. Conidiophores were light brown, cylindrical, simple or sometimes branched at the base, and 105 to 202 × 3 to 5 μm. Separating cells were hyaline, oval, and 12 to 13 × 4 to 5 μm. Conidia were unequally biconic, unicellular, dark brown with a pale brown or subhyaline band just above the widest part, and 26 to 31 × 8.5 to 12 μm (mean 27.3 × 10.6 μm) with a conspicuous appendage at the apex that was 6 to 14 × 1 to 1.8 μm. These characteristics were consistent with the description of Beltrania rhombica Penz. (3). The internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA) of one isolate (GenBank Accession No. JN853777) was amplified using primers ITS4 and ITS5 (4) and sequenced. A BLAST search in GenBank revealed 97% similarity to the ITS sequence of an isolate of B. rhombica (GU797390.1). To confirm pathogenicity of the isolate, ten detached leaves from 3-month-old plants of T. semidecandra ‘Purple Glorybush’ were inoculated in vitro with 5-mm diameter, colonized mycelial plugs from the periphery of 5-day-old cultures of the isolated fungus. The agar plugs were put on the leaf surface and secured with sterile, moist cotton. Sterile PDA plugs were similarly used as the control treatment on ten detached leaves. Leaves were placed in petri dishes and incubated in a growth chamber with 12 h of light/day at 28°C. Necrotic lesions appeared on leaves after 2 to 3 days of incubation, whereas control leaves inoculated with sterile PDA plugs remained asymptomatic. B. rhombica was consistently reisolated from the lesions using the same method described above, but was not reisolated from the control leaves. Although there are approximately 77 reported hosts of B. rhombica (2), to our knowledge, this is the first report of B. rhombica causing a leaf spot on T. semidecandra. Because the disease caused foliar damage and reduced the ornamental value of the nursery plants, control measures may need to be implemented for this species in nurseries. References: (1) M. Faravani and B. H. Bakar. J. Food Agric. Env. Pap. 5:234, 2007. (4) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 30 Mar. 2012. (2) K. A. Pirozyski and S. D. Patil. Can. J. Bot. Pap. 48:567, 1970. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Anthracnose Caused by Colletotrichum gloeosporioides on Cymbidium sinense in China

Plant Disease ◽  
2012 ◽  
Vol 96 (6) ◽  
pp. 915-915 ◽  
Author(s):  
J. H. Huang ◽  
Z. R. Shi ◽  
Y. X. Zhang ◽  
M. M. Xiang
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
Its Region ◽  
Leaf Margin ◽  
Single Spore ◽  
First Report ◽  
Plastic Bags ◽  
Agar Plug ◽  
Pure Cultures ◽  
And Control ◽  
Cymbidium Sinense

Cymbidium sinense are among the most important commercial orchids cultivated in China for flower production. In April of 2010, a leaf spot was sporadically observed on C. sinense in fields located in Guangzhou, China. Symptoms first appeared as yellow to brown, irregular-shaped lesions on the leaf margin or tip. As the infection continued on the tissues, the spot expanded and became dark brown along the margins and developed gray brown centers. At later stages, numerous epidermal acervuli developed on the lesions and mucilaginous conidial masses appeared on the lesions under moist conditions. Ten samples from tissue along the margins of lesions were collected and surface sterilized by washing in 70% ethanol for 30 s, followed by washing in 1% sodium hypochlorite for 30 s, and rinsing in sterile distilled water. These samples were plated onto potato dextrose agar (PDA) and incubated at 25°C with a 12-h alternating light and dark cycle. After 5 days, fungal colonies that grew from the tissue were subcultured onto PDA and pure cultures were obtained using the single-spore method. The fungus was identified as Colletotrichum gloeosporioides based on typical cultural characteristics and conidial morphology (1). PDA cultures were white at first and subsequently became grayish white to gray and pink to reddish brown. Conidia were straight, one-celled, hyaline, oblong, or cylindrical, slightly curved with truncate base and rounded apex and measured 14.0 to 19.5 × 4.0 to 6.0 μm. Chlamydospores, sclerotia, and a teleomorph were not found. Genomic DNA was extracted from one isolate and the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1-5.8S-ITS2) was amplified using ITS1 (5′-TCCGTAGGTGAACCTGCGG-3′) and ITS4 (5′-CCTCCGCTTATTGATATGC-3′) primers. The ITS region was further cloned and sequenced and showed 100% homology with many GenBank sequences (e.g., HQ333546.1) of C. gloeosporioides as the closest match. Pathogenicity tests were done by transferring one 4-mm-diameter disk of PDA that was colonized by the test isolates to wounds (4 × 4 mm) made with a needle in the leaves of 1-year-old C. sinense plants. Control plants received a sterile agar plug in wound. Ten inoculated plants were covered with plastic bags to maintain a high relative humidity and maintained in a greenhouse at 25 ± 2°C for 72 h. Five days after inoculation, no symptoms developed on the control plants. Foliar lesions closely resembled those observed in the field. C. gloeosporioides was reisolated consistently from symptomatic tissue collected from greenhouse experiments. To our knowledge, this is the first report of C. gloeosporioides causing anthracnose on C. sinense in China. Reference: (1) B. C. Sutton. Colletotrichum Biology, Pathology and Control. CAB International, Wallingford, UK, 1992.

scholarly journals First report of postharvest fruit rot on passion fruit (Passiflora edulis) caused by Lasiodiplodia theobromae in Mainland China

Plant Disease ◽  
2020 ◽  
Author(s):  
Wu Zhang ◽  
Xue Li Niu ◽  
Jin Yu Yang
Keyword(s):  
Southern China ◽  
Morphological Characteristics ◽  
Its Region ◽  
Passion Fruit ◽  
Fruit Rot ◽  
Pathogenicity Test ◽  
Single Spore ◽  
Passiflora Edulis ◽  
Lasiodiplodia Theobromae ◽  
First Report

As an economically important tropical and subtropical fruit crop, passion fruit (Passiflora edulis Sims) is widely planted in many provinces of southern China. In April 2017, postharvest fruit rot was observed on 15% to 25% of passion fruit in several fruit markets of Zhanjiang City in Guangdong Province. Initial disease symptoms on infected fruit were irregular, brown, water-soaked lesions, which enlarged into large black and sunken patches. Lesions were usually covered with an abundance of little black dots (pycnidia) and black-gray hyphae. For the pathogen isolation, fifteen symptomatic fruit were randomly collected from three local markets. Fourteen single-spore fungal isolates with similar morphology ware isolated from the infected tissues. Two isolates (ZW 49-1 and ZW 50-1) were randomly selected to further study. The colonies on PDA were initially greyish-white and became dark-gray with age. Abundant globular and irregular pycnidia were observed after incubation at 25 °C for 3 weeks. The conidia of the fungus were initially hyaline, unicellular, apex rounded, thick-walled, and ellipsoid, becoming dark brown, bicellular with longitudinal striations at maturity, 26.4 ± 2.5 × 13.4 ± 1.2 μm (n = 50). The morphology of the fungus resembled Lasiodiplodia theobromae (Pat.) Griff. & Maubl. (Phillips et al. 2013). To confirm species identification, the partial internal transcribed spacer (ITS) region of rDNA, translation elongation factor-alpha (EF1-α) and β-tubulin (TUB) gene were amplified from genomic DNA of the two isolates with the ITS1/ITS4, EF1-688F/EF1-986R, and Bt2a/Bt2b primers, respectively (Glass and Donaldson 1995; Alves et al. 2008; White et al. 1990). Base on the BLASTn analysis, the ITS (MT644473, MT644474), EF1-α (MT649210, MT649211) and TUB (MT649212, MT649213) sequences of both isolates were 100%, 99% and 100% similarity to the L. theobromae CBS 164.96 ex-type sequences in the NCBI database (AY640255, AY640258, and KU887532, respectively) (Phillips et al. 2013). For pathogenicity test, asymptomatic passion fruit were previously disinfested in 0.5 % sodium hypochlorite and superficially wounded with a sterile needle. Five-mm-diameter plugs with mycelial taken from 5-day-old PDA colonies were placed on the wounds. Sterile PDA plugs were used as negative controls. Each treatment had five replicates and the test was repeated twice. Fruit were maintained in plastic boxes to keep at 25°C for one week. One week after inoculation, gray mycelia had covered a majority of the fruit surface and caused a black, sunken rot. The inoculated fungus was reisolated and confirmed as L. theobromae by morphological characteristics. The mock inoculated fruit remained asymptomatic. The occurrence of fruit rot on passion fruit caused by L. theobromae was reported in Taiwan, China recently (Huang et al., 2019). To our knowledge, this is the first report of L. theobromae causing postharvest fruit rot on passion fruit in the Chinese mainland.

Sign in / Sign up

Export Citation Format

Share Document