First Report of Hop Stunt Viroid Infecting Hop in Ohio

Here, we report complete genome sequences of grapevine yellow speckle viroid 1 (GYSVd1) and hop stunt viroid (HSVd), members of the family Pospiviroidae , assembled from the transcriptome data generated from Ixeridium dentatum plants. To our knowledge, this is the first report of GYSVd1 and HSVd in I. dentatum .

Download Full-text

First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Plant Disease ◽

10.1094/pdis-04-21-0863-pdn ◽

2021 ◽

Author(s):

Dong Xu ◽

Charith Raj Adkar-Purushothama ◽

Pierre Lemoyne ◽

Jean Pierre Perreault ◽

Mamadou Fall

Keyword(s):

Rna Extraction ◽

Leaf Tissue ◽

Positive Sequence ◽

Wine Grape ◽

Library Preparation ◽

Rt Pcr ◽

Tissue Samples ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

Download Full-text

First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽

10.1094/pdis.2003.87.12.1537b ◽

2003 ◽

Vol 87 (12) ◽

pp. 1537-1537 ◽

Cited By ~ 1

Author(s):

M. Hassan ◽

P. Rysanek ◽

F. Di Serio

Keyword(s):

Czech Republic ◽

Stone Fruit ◽

Reference Sequence ◽

Mixed Infections ◽

Rt Pcr ◽

The Czech Republic ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Download Full-text

First Report of Hop stunt viroid in Peach Trees in Korea

Plant Disease ◽

10.1094/pdis-06-16-0823-pdn ◽

2016 ◽

Vol 100 (12) ◽

pp. 2543-2543 ◽

Cited By ~ 1

Author(s):

Y. H. Jo ◽

H. S. Chu ◽

J. K. Cho ◽

S. Lian ◽

H. S. Choi ◽

...

Keyword(s):

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Peach Trees

Download Full-text

First Report of Hop stunt viroid From Sweet Cherry With Dapple Fruit Symptoms in China

Plant Disease ◽

10.1094/pdis-08-16-1086-pdn ◽

2017 ◽

Vol 101 (2) ◽

pp. 394-394 ◽

Cited By ~ 5

Author(s):

L. Xu ◽

J. W. Wang ◽

D. Z. Zhu ◽

X. J. Zong ◽

H. R. Wei ◽

...

Keyword(s):

Sweet Cherry ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid

Download Full-text

First Report of Hop stunt viroid in Apricot in China

Plant Disease ◽

10.1094/pd-90-0828c ◽

2006 ◽

Vol 90 (6) ◽

pp. 828-828 ◽

Cited By ~ 5

Author(s):

Y. A. Yang ◽

H. Q. Wang ◽

R. Guo ◽

Z. M. Cheng ◽

S. F. Li ◽

...

Keyword(s):

Polyacrylamide Gel Electrophoresis ◽

Rt Pcr ◽

First Report ◽

Republic Of China ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Viroid Infection ◽

Wide Range ◽

Irregular Border ◽

Apricot Tree

Hop stunt viroid (HSVd), a member of the family Pospiviroidae, was first described as the causal agent of hop stunt disease in Japan. It has since been found in a wide range of hosts including herbaceous and woody hosts (e.g., hop, cucumber, grapevine, citrus, plum, peach, pear, apricot, almond, and pomegranate). It was also detected and characterized in apricot where infection appears to be latent (1). The viroid occurs frequently in apricot. In southeastern Spain, the presence of HSVd was found to infect 81% of apricot trees (2). Apricots originated in China and are extensively cultivated, but HSVd infection in this host has not been reported. In September 2005, a single symptomatic apricot tree, ‘Yin Bai’, one of the most popular and widely grown cultivars in China, was discovered at the Institute of Fruit Science in Changping District in Beijing, Peoples Republic of China. Observed symptoms included a number of yellow spots with an irregular border that scattered in an irregular manner over the leaf surface. Total RNA was extracted and used for return-polyacrylamide gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR) (4). Results of both assays were positive for HSVd. A 297-bp full-length DNA fragment was amplified by RT-PCR using primers R1 (5′-GCTGGATTCTGAGAAGAGTT-3′) complementary to HSVd residues 87–106 for the RT reaction, followed by R2 (5′-AACCCGGGGCTCCTTTCTCA-3′) complementary to HSVd residues 67–84 and forward primer F3 (5′-AACCCGGGGCAACTCTTCTC-3′) residues 79–96 for PCR. The primers are located in the strictly conserved central region of the conserved HSVd group and contain the unique endonuclease restriction site SmaI. The amplified products were cloned into pGEM-T (Promega, Madison, WI) and selected for further analysis on the basis of the results of restriction digests. Six individual clones were sequenced and three different sequences were obtained. Nucleic acid sequence (GenBank Accession No. DQ362901) obtained from one clone was 99.3% (nucleotide changes T206→C, C233→T) identical to HSVd.apr8 (GenBank Accession No. Y09349) (3). Sequence (GenBank Accession No. DQ362904) obtained from three clones was 99.7% (nucleotide change C233→T) and a third sequence (GenBank Accession No. DQ362905) obtained from two clones was 99.3% (nucleotide changes G107→A, C233→T) identical to HSVd.apr8. Further investigation is necessary to determine whether the symptoms observed are associated with the viroid infection. To our knowledge, this is the first report of HSVd isolated from apricot in China. References: (1) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañzres et al. Acta Hortic. 472:581, 1998. (3) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997. (4) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

Download Full-text