scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

scholarly journals First Report of Peach latent mosaic viroid in Peach Trees in Montenegro

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 150-150 ◽  
Author(s):  
I. Mavric Pleško ◽  
M. Viršcek Marn ◽  
Z. Miladinovic ◽  
J. Zindovic
Keyword(s):  
Prunus Persica ◽  
Stone Fruit ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
First Report ◽  
Fruit Species ◽  
Hop Stunt Viroid ◽  
Viroid Infection ◽  
Fruit Samples ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to infect stone fruit species worldwide. The viroid infection can be latent or induce a variety of disease symptoms. Stone fruit samples were collected in Montenegro for a Plum pox virus (PPV) survey in 2007. Thirteen samples infected with PPV, taken from 12-year-old peach trees (Prunus persica (L.) Batsch, cv. Elegant Lady) in the area of Cemovsko field, were tested for the presence of PLMVd and HSVd by reverse transcription (RT)-PCR. Mild or severe mosaic, chlorotic rings, and fruit deformations were observed on some trees. Total RNA was extracted from all samples with a RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and RT-PCR was performed. Samples were tested for HSVd and PLMVd infection using primer pairs RF-43/RF-44 for PLMVd (1) and VP-19/VP-20 for HSVd (2). Amplification products of approximately 348 bp were obtained from nine samples with PLMVd primers. Amplification products from seven samples were successfully cloned into pGEM-T Easy Vector (Promega, Madison, WI) and used for transformation of Escherichia coli. At least four clones of each sample were sequenced. Obtained sequences were 337 and 338 nucleotides long and shared 90.3 to 100% identity. Consensus sequences of each sample were deposited in GenBank under Accession Nos. JF927892–JF927898. They showed 92.6 to 97.9% identity among each other, 94 to 98% identity with the PLMVd isolate G sequence (Accession No. EF591868) and 91.8 to 94.4% identity with PLMVd sequence M83545. HSVd was not detected in analyzed samples. PLMVd infections were found on peach trees in an area where approximately 40% of the peach production is located. Therefore, PLMVd infections can pose a threat to peach production in Montenegro. To our knowledge this is the first report of PLMVd infection of peach in Montenegro. References: (1) S. Ambrós et al. J. Virol. 72:7397, 1998. (2) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997.

scholarly journals First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Plum (Prunus domestica) in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 461-461 ◽  
Author(s):  
D. Šafářová ◽  
M. Navrátil ◽  
C. Faure ◽  
T. Candresse ◽  
A. Marais
Keyword(s):  
Czech Republic ◽  
Amino Acid ◽  
Leaf Spot ◽  
Fruit Trees ◽  
Stone Fruit ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Spot Virus ◽  
The Czech Republic ◽  
Chlorotic Leaf

Apricot pseudo-chlorotic leaf spot virus (APCLSV) is a novel, still poorly known Trichovirus in the family Betaflexiviridae. It is most closely related to Apple chlorotic leaf spot virus (ACLSV) (2,4) and infects stone fruit trees of the Prunus genus. Its presence has so far been detected in apricot, plum, Japanese plum, and peach trees in Italy, Spain, France, Hungary, Turkey, Jordan, and Australia (1,2,4). During the summers of 2008 and 2010, leaf samples of old Czech local plum cultivars were obtained from the Holovousy collection and assessed for the presence of viruses belonging to the Capillovirus, Trichovirus, and Foveavirus genera using the polyvalent degenerate oligonucleotides (PDO) nested reverse transcription (RT)-PCR test (3). Following amplification from total RNAs extracts, the amplicons were cloned and several clones were sequenced for each plant sample. In plum (Prunus domestica) cv. Babce, a mixture of amplicons was observed and BlastN and BlastX analyses of the obtained sequences revealed the presence of ACLSV and APCLSV. The 310-bp APCLSV amplicon (GenBank Accession No. JN790294) showed highest identity (82.9% in nucleotide sequence and 97.1% in amino acid sequence) with the Sus2 isolate of APCLSV (4) and clustered with APCLSV isolates in a phylogenetic analysis. APCLSV infection was further confirmed with an APCLSV-specific RT-PCR assay (4), which yielded a product of the expected 205-bp size (GenBank Accession No. JN653070) with closest homology again to the Sus2 APCLSV isolate (83.4 and 94.3% nucleotide and amino acid identity, respectively). To our knowledge, this finding represents the first detection of APCLSV in domestic plums in the Czech Republic, extending our vision of APCLSV diversity and its geographic distribution. For unknown reasons, APCLSV has almost always been reported in mixed infection with ACLSV (1,2,4) and the situation in cv. Babce does not deviate from this trend. This has greatly hindered the analysis of the pathogenicity of APCLSV, a situation further complicated in the current case because the Babce cultivar was also infected by Plum pox virus. References: (1) M. Barone et al. Acta Hortic. 781:53, 2008. (2) T. Candresse et al. Virus and Virus-Like Diseases of Pome and Stone Fruit Trees. A. Hadidi et al., eds. The American Phytopathological Society, St. Paul, MN, 2011. (3) X. Foissac et al. Phytopathology 95:617, 2005. (4) D. Liberti et al. Phytopathology 95:420, 2005.

scholarly journals First Report of Hop stunt viroid Infecting Japanese Plum, Cherry Plum, and Peach in Greece

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1662-1662 ◽  
Author(s):  
M. S. Kaponi ◽  
P. E. Kyriakopoulou
Keyword(s):  
Stone Fruit ◽  
Economic Losses ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Japanese Plum ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Fruit Skin ◽  
Viroid Infection ◽  
Field Samples

Dapple plum and peach fruit is a widely distributed disorder of plum and peach resulting in significant economic losses (4). During a survey for the presence of Hop stunt viroid (HSVd) on stone fruit trees in Greece, samples from 30 European plums (Prunus domestica L., cvs. President, Tuleu Grass), 45 Japanese plums (Prunus salicina Lindl., cvs. Angeleno, Diamond, Santa Rosa), 12 cherry plums (Prunus domestica L. var. insititia (L.) Fiori & Paoletti of unknown cultivar), and 107 peaches (Prunus persica (L.) Batsch, cvs. Red Haven, Elberta, June Gold, Spring Crest, Lemonato) were collected in several orchards around Greece. Their fruit skin symptomatology indicated viroid infection (reddish dappling blotches and cracks in European and Japanese plum, green dappling in cherry plum, and light colored blotches and lines in peach). Samples were screened with tissue-print hybridization (TPH) for HSVd using a full length DIG-labelled riboprobe deriving from in vitro transcription of the positive control, a citrus isolate of HSVd (G. Vidalakis, CCPP, University of California, Riverside). In total, 44 out of the 194 trees surveyed were HSVd-positive with TPH. For a small number (40) of TPH-positive field samples, TNA phenol extraction from fruit skin, leaves, and bark and one-tube two-step reverse transcription (RT)-PCR assays followed, using a standardized protocol (3) with two different primer pairs, one new primer pair (this study) and a previously reported primer pair (2). RT-PCR analysis showed the presence of HSVd in peach and Japanese plum in prefectures Pella (Central Macedonia), Achaia, and Korinthia (Peloponnesus) and in cherry plum in Achaia (Peloponnesus). Six of 11 Japanese plums (cvs. Angeleno, Santa Rosa), 2 of 12 cherry plums, and 8 of 12 peaches (cvs. Spring Crest, Red Haven) examined were found HSVd-infected, but none of the five European plums were. Nucleotide sequence analyses of purified and cloned amplicons from peaches and Japanese and cherry plums revealed sizes of 297 to 308 nt and similarity to sequence variants of other HSVd isolates previously characterized: 95 to 97% identity with the Moroccan isolates apr.9, apr.10, apr.11, and apr.12 and the Spanish isolate apr.4 from apricot (1) (GenBank Accession Nos. AJ297825 to AJ297828 and Y09346, respectively). For confirmation of HSVd presence in field trees, 10 Japanese plums cv. Angeleno, 10 peaches cv. June Gold, and 10 peaches cv. Spring Crest, HSVd-negative (TPH), were bud- or chip-grafted from two of the aforementioned Japanese plums cv. Angeleno and two of the aforementioned peaches cv. Red Haven. Two years later, five Japanese plum trees (cv. Angeleno) and five peach trees (three cv. Spring Crest and two cv. June Gold) were found HSVd-positive with TPH; no fruits were observed to produce fruit symptoms as the grafted trees were kept in an insect-proof greenhouse (no bees for cross-pollination). To our knowledge, our investigation reports for the first time the occurrence of HSVd infecting Japanese plum, cherry plum, and peach in Greece, emphasizing the need for a certification program for the prevention of spreading stone fruit tree viroids in this country. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (3). F. Faggioli et al. Acta. Hort. 550:59, 2001. (4) T. Sano et al. J. Gen. Virol. 70:1311, 1989.

scholarly journals First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Plant Disease ◽  
2021 ◽  
Author(s):  
Dong Xu ◽  
Charith Raj Adkar-Purushothama ◽  
Pierre Lemoyne ◽  
Jean Pierre Perreault ◽  
Mamadou Fall
Keyword(s):  
Rna Extraction ◽  
Leaf Tissue ◽  
Positive Sequence ◽  
Wine Grape ◽  
Library Preparation ◽  
Rt Pcr ◽  
Tissue Samples ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

scholarly journals First Report of Hop stunt viroid in Peach Trees in Korea

Plant Disease ◽  
2016 ◽  
Vol 100 (12) ◽  
pp. 2543-2543 ◽  
Author(s):  
Y. H. Jo ◽  
H. S. Chu ◽  
J. K. Cho ◽  
S. Lian ◽  
H. S. Choi ◽  
...  
Keyword(s):  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

scholarly journals First Report of Hop stunt viroid in Apricot in China

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 828-828 ◽  
Author(s):  
Y. A. Yang ◽  
H. Q. Wang ◽  
R. Guo ◽  
Z. M. Cheng ◽  
S. F. Li ◽  
...  
Keyword(s):  
Polyacrylamide Gel Electrophoresis ◽  
Rt Pcr ◽  
First Report ◽  
Republic Of China ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Viroid Infection ◽  
Wide Range ◽  
Irregular Border ◽  
Apricot Tree

Hop stunt viroid (HSVd), a member of the family Pospiviroidae, was first described as the causal agent of hop stunt disease in Japan. It has since been found in a wide range of hosts including herbaceous and woody hosts (e.g., hop, cucumber, grapevine, citrus, plum, peach, pear, apricot, almond, and pomegranate). It was also detected and characterized in apricot where infection appears to be latent (1). The viroid occurs frequently in apricot. In southeastern Spain, the presence of HSVd was found to infect 81% of apricot trees (2). Apricots originated in China and are extensively cultivated, but HSVd infection in this host has not been reported. In September 2005, a single symptomatic apricot tree, ‘Yin Bai’, one of the most popular and widely grown cultivars in China, was discovered at the Institute of Fruit Science in Changping District in Beijing, Peoples Republic of China. Observed symptoms included a number of yellow spots with an irregular border that scattered in an irregular manner over the leaf surface. Total RNA was extracted and used for return-polyacrylamide gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR) (4). Results of both assays were positive for HSVd. A 297-bp full-length DNA fragment was amplified by RT-PCR using primers R1 (5′-GCTGGATTCTGAGAAGAGTT-3′) complementary to HSVd residues 87–106 for the RT reaction, followed by R2 (5′-AACCCGGGGCTCCTTTCTCA-3′) complementary to HSVd residues 67–84 and forward primer F3 (5′-AACCCGGGGCAACTCTTCTC-3′) residues 79–96 for PCR. The primers are located in the strictly conserved central region of the conserved HSVd group and contain the unique endonuclease restriction site SmaI. The amplified products were cloned into pGEM-T (Promega, Madison, WI) and selected for further analysis on the basis of the results of restriction digests. Six individual clones were sequenced and three different sequences were obtained. Nucleic acid sequence (GenBank Accession No. DQ362901) obtained from one clone was 99.3% (nucleotide changes T206→C, C233→T) identical to HSVd.apr8 (GenBank Accession No. Y09349) (3). Sequence (GenBank Accession No. DQ362904) obtained from three clones was 99.7% (nucleotide change C233→T) and a third sequence (GenBank Accession No. DQ362905) obtained from two clones was 99.3% (nucleotide changes G107→A, C233→T) identical to HSVd.apr8. Further investigation is necessary to determine whether the symptoms observed are associated with the viroid infection. To our knowledge, this is the first report of HSVd isolated from apricot in China. References: (1) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañzres et al. Acta Hortic. 472:581, 1998. (3) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997. (4) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

scholarly journals Molecular sampling of hop stunt viroid (HSVd) from grapevines in hop production areas in the Czech Republic and hop protection

2011 ◽  
Vol 49 (No. 4) ◽  
pp. 168-175 ◽  
Author(s):  
J. Matoušek ◽  
L. Orctová ◽  
J. Patzak ◽  
P. Svoboda ◽  
LudvíkováI
Keyword(s):  
Pcr Primers ◽  
Heteroduplex Analysis ◽  
Library Screening ◽  
Potential Danger ◽  
Rt Pcr ◽  
The Czech Republic ◽  
Stunt Viroid ◽  
Biological Potential ◽  
Hop Stunt Viroid ◽  
Production Areas

Molecular sampling of HSVd in grapevines in the environs of hop gardens was performed. Specific RT PCR primers were designed to unambiguously distinguish between HLVd and HSVd infections. These primers were used for detection and analysis of HSVd cDNAs from individual samples by thermodynamic methods, TGGE and cDNA heteroduplex analysis. We found that at least 70% of grapevine samples from locations close to hop gardens inNorthern Bohemia(Žatec and Úštěk hop production areas) were infected with HSVd forming populations containing quasispecies. Particular sequence variants, dominant in grapevines from wine-growing areas like Znojmo, were also found in minor private vineyards. HSVd was experimentally transmissible (80% success) from these samples to Osvald’s clone 72 of Czech hop, where according to the cDNA library screening, one of the dominant HSVdg variants corresponding to AC E01844 was detected in early populations three weeks p.i. HSVd was detected neither in reproduction materials nor in examined hop gardens. However a potential danger for hop cultivation, consisting in the high biological potential of HSVd spread is discussed.

scholarly journals First Report of Peach latent mosaic viroid Infecting Peach in Egypt

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 649-649 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
M. Malfitano ◽  
D. Alioto
Keyword(s):  
Blot Hybridization ◽  
Leaf Tissue ◽  
Stone Fruit ◽  
Rt Pcr ◽  
Dot Blot ◽  
First Report ◽  
Detection Techniques ◽  
Mediterranean Countries ◽  
Canadian Isolate ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) is a widespread pathogen of stone fruit trees in some European and Mediterranean countries and also in North America. To access the presence of the viroid in Egypt, a survey was conducted that covered five commercial peach orchards in the El Khatatba Region in Al Minufiya Governorate. During 2003 and 2004, 73 peach trees (cv. Florida grafted on Nemagard rootstock) were visually inspected and sampled. No symptoms characteristic of PLMVd infection, such as mosaic, delayed growth, or fruit suture cracking, were observed. All samples were tested for the presence of PLMVd using dot-blot hybridization and reverse transcription (RT)-PCR. Aliquots (5 μl) of total nucleic acids extracted from approximately 2 mg of leaf tissue were spotted onto positively charged nylon membranes and hybridized under stringent conditions with a digoxigenin-labeled riboprobe (2). The extracts (1 μl) also were used in RT-PCR as described (1). Only 1 of the 73 peach trees was positive for PLMVd using these detection techniques. The RT-PCR product was of the size expected for PLVMd and was cloned and sequenced. The 339 nucleotide sequence was deposited in GenBank as Accession No. DQ839564. The sequence of this Egyptian PLMVd isolate was 94% identical to the reference PLMVd variant (GenBank Accession No. M83545) and most closely (95%) related to Canadian isolate variant 16 (GenBank Accession No. AJ550911). Such a low incidence compared with other countries may be because the survey was restricted to a limited number of samples, conducted on newly reclaimed lands where no sources of infection existed before, and material with relatively low PLMVd incidence might have been used for planting. Although the incidence of PLMVd was low in this survey, the occurrence represents a threat to the stone fruit tree industry in this country and regular screening of PLMVd in certification programs is suggested. To our knowledge, this is the first report of PLMVd on peach in Egypt. References: (1) S. Loreti et al. EPPO Bull. 29:433, 1999. (2) A. M. Shamloul et al. Acta Hortic. 386:522, 1995.

scholarly journals First Report of Mixed Infection of Hop stunt viroid and Peach latent mosaic viroid on Peach

Plant Disease ◽  
2002 ◽  
Vol 86 (3) ◽  
pp. 329-329 ◽  
Author(s):  
M. Tessitori ◽  
A. Reina ◽  
R. La Rosa
Keyword(s):  
Polyacrylamide Gel Electrophoresis ◽  
First Report ◽  
Stunt Viroid ◽  
Phenol Extraction ◽  
Detection And Identification ◽  
Rna Probes ◽  
Hop Stunt Viroid ◽  
Fruit Disease ◽  
Specific Disorders ◽  
Peach Trees

Hop stunt viroid (HSVd), belonging to the family Pospiviroidae, was first reported in hop, but infects several plant species, including herbaceous and woody hosts (e.g., grapevine, pear, peach, plum [2], apricot, almond, and pomegranate). In grapevine and apricot, the viroid appears to be latent. However, in other species, the viroid is associated with specific disorders: hop stunt, dapple fruit disease of plum and peach (2), and citrus cachexia. During spring 2000, stunted trees exhibiting delayed budbreak were observed in peach, cv. Redhaven, orchards in Sicily. In the summer of 2000, peach leaves were collected from symptomatic trees, triturated, and used to purify total nucleic acids by phenol extraction followed by CF-11 cellulose-chromatography. Viroid RNAs were detected by sequential polyacrylamide gel electrophoresis (sPAGE) and silver staining. Citrus exocortis viroid (371 nt) and Citrus viroid IIIb (294 nt) were used as standards. Nonradioactive hybridizations with digoxigenin (DIG)-labeled, Peach latent mosaic viroid (PLMVd) and HSVd RNA probes were used in viroid detection and identification. Predicted sizes of the viroid RNAs calculated in sPAGE and DIG probe hybridization demonstrated that ‘Redhaven’ peach trees were infected with PLMVd and HSVd. These results provide the first evidence of the contemporary presence of HSVd and PLMVd in peach trees. To our knowledge, this is the first report of HSVd in peach trees in Italy. Molecular characterization of this HSVd isolate is in progress to determine the nucleotide sequence of some of the variants in the population and to decide to which of the five proposed HSVd groups (1) this isolate should be assigned. Reference: (1) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997. (2) T. Sano et al. J. Gen. Virol. 70:1311, 1989.

Sign in / Sign up

Export Citation Format

Share Document