Integrative time-scale and multi-omic analysis of host-responses to Hop stunt viroid infection

Constricted by an extreme biological simplicity, viroids are compelled to subvert host regulatory networks in order to accomplish their infectious process. Most of the studies focused on the response to viroid infection have only addressed a specific host regulatory level and considered a unique infection time. Thus, much remains to be done if we want to understand the temporal evolution and complex nature of viroid-host interactions. Here we present an integrative analysis of the timing and intensity of the genome-wide alterations in cucumber plants infected with Hop stunt viroid (HSVd). Differential host transcriptome, sRNAnome and methylome were integrated to determine the temporal response to viroid-infection. Our results support that HSVd promotes a dynamic redesign of the cucumber regulatory pathways predominantly affecting specific regulatory layers at different infection phases. Remarkably, the initial response was characterized by a reconfiguration of the host transcriptome by differential exon usage, followed by a predominant down-regulation of the transcriptional activity possibly modulated by the host epigenetic changes associated to infection and characterized by an increased hypermethylation. The silencing of at least three cucumber transcripts potential targets of vd-sRNAs was also observed. The alteration in host sRNA and miRNA metabolism was marginal. We expect that these data constituting the first comprehensive map of the cucumber-response to HSVd could contribute to elucidate the molecular basis of the host alterations triggered by viroid infection.

First report of grapevine virus L infecting grapevine in southeast France

Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l’Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3’ end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the “Plan National Dépérissement du Vignoble” (Mycovir project) for the financial support

La importancia de la aplicación de micorrizas para disminuir la abscisión de naranja (Citrus sinensis L. Osbeck) en Veracruz, México / The importance of the application of mycorrhizae to reduce abscission of orange in Veracruz, Mexico

México es el cuarto productor de cítricos a nivel mundial (FAOSTAT, 2019) y el estado de Veracruz aporta el 53 % de la producción nacional (SIAP, 2019). El problema de la abscisión de frutos de naranja cobró importancia en 2017, pero ya existía este problema desde hace 15 años, lo cual ocasiona pérdidas en la producción del 20% en la zona Norte de Veracruz (Gómez et al., 2020). El ataque de patógenos: Colletotrichum spp, Botryodiplodia spp, Fusarium spp, Citrus tristeza virus (VTC), Candidatus Liberibacter asiaticus (CLas), Citrus exocortis viroid (CEVd) y Hop stunt viroid (HSVd); pueden influir, entre otros factores, en la caída de naranja. El experimento se llevó a cabo en la huerta `Grupo Los Gómez’ en el ejido de San Pablo, Papantla, Veracruz, México; en naranja ‘Valencia’ portainjerto ‘Agrio’ y en suelo tipo aluvión. El objetivo central de la investigación fue evaluar 15 insumos agroecológicos para disminuir la abscisión de naranja, 7 de estos insumos con micorrizas y el resto sin su aplicación. Los tratamientos con mejores resultados fueron: Agua de vidrio (1.25 %) + Micorriza; Optifer amino (0.5 %) + Micorriza; y EM (5 %) + Micorriza con menor porcentaje de caída de naranja con 4.97%, 5.79%, 6.10% respectivamente.

First Report of Grapevine Kizil Sapak Virus in Grapevine in China

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. ‘Crimson Seedless’ (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5’-TAGTCTGGATTTCCCTACCT/5’-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5’-GCCACTGGTGAATGAAAAGA/5’-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5’ and 3’ termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5’/3’ Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a ‘Black Monukka’ grape (native to India) also sampled from Xinjiang. Both PCR products of ‘Black Monukka’ were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3’-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5’- GAAGCAACAGTGCCCGTCTC -3’) and GRVFV-R1 (5’- AGGTCGCTTTACGGACCTTTTCTT -3’). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

Hop stunt viroid (hop stunt viroid).

Hop stunt viroid (HSVd) is a covalently closed, single-stranded RNA molecule of 297 nucleotides (Sano et al., 1985). Variants consisting of 294-303 nucleotides have been described from different hosts (Kofalvi et al., 1997; Amari et al., 2001). HSVd has a rod-like conformation with five domains, a central conserved region (CCR) similar to members of genera Pospiviroid and Cocadviroid, and a terminal conserved hairpin (TCH) which is also present in the genus Cocadviroid (Flores et al., 1997). Replication is known to occur through an asymmetric, rolling-circle model because longer-than-unit minus strands have been found in infected tissue (Flores et al., 2005). HSVd was named due to the first identification of the pathogen on hop plants originating from Japan (Yamamoto et al., 1973). In a wide range of host species, infection by HSVd appears to be latent, whereas in hop, Citrus and Prunus species it causes specific disorders and economic damage (Hadidi et al., 2003).

Cultivated and wild grapevines in Tennessee possess overlapping but distinct virus populations

Viruses and viroids prevalent in a population of 42 wild grapevines (i.e., free-living, uncultivated grapevines; Vitis spp.) were compared to those in a population of 85 cultivated grapevines collected in Tennessee, USA by RNA-seq analysis of pools of ribosomal RNA-depleted total RNA. The sequences of 10 viruses (grapevine fleck virus, grapevine leafroll-associated virus 2, grapevine rupestris stem pitting-associated virus, grapevine Syrah virus 1, grapevine vein-clearing virus, grapevine virus B, grapevine virus E, tobacco ringspot virus, tomato ringspot virus and a novel nano-like virus) and two viroids (hop stunt viroid and grapevine yellow speckle viroid 1) were detected in both grapevine populations. Sequences of four viruses (grapevine associated tymo-like virus, grapevine leafroll-associated virus 3, grapevine red blotch virus and grapevine virus H) were identified only from cultivated grapevines. High, moderate and low numbers of sequence reads were identified only from wild grapevines for a novel caulimovirus, an enamovirus, and alfalfa mosaic virus, respectively. The presence of most virus sequences and both viroids was verified independently in the original samples by reverse transcription-polymerase chain reaction followed by Sanger sequencing. Comparison of viral sequences shared by both populations showed that cultivated and wild grapevines harbored distinct sequence variants, which suggests that there was limited virus movement between the two populations. Collectively, this study represents the first unbiased survey of viruses and viroids in both cultivated and wild grapevines within a defined geographic region.

A Current Overview of Two Viroids Prevailing in Citrus Orchards: Citrus Exocortis Viroid and Hop Stunt Viroid

Citrus exocortis viroid (CEVd) and hop stunt viroid (HSVd) are the main viroids circulating in all citrus-growing areas worldwide, and causing two well-known diseases on citrus trees; exocortis and cachexia, respectively. These viroids are small, covalently closed single-stranded RNA, allocated to the Pospiviroidae family. CEVd is the first viroid being described on citrus trees in 1948 in California. It is considered the largest citrus viroid at 371 nucleotides. It causes bark scaling disorder on the rootstock of citrus trees grafted on trifoliate orange and its hybrids and can cause dwarfing of trees grown on these rootstocks. HSVd was first observed in 1945 in Florida. It consists of 299 nucleotides. Stunting, chlorosis, bark gumming, stem pitting, decline, and depressions in the wood are the main symptoms of HSVd in mandarin and its hybrids. The introduction and propagation of infected budwoods are the main causes of viroids spread in citrus orchards. These agents are mechanically sap-transmissible and spread by contaminated tools. Neither seed transmission nor vectors have been reported for both viroids. Root transmission, though possible, would be overshadowed by mechanical transmission. Rapid and sensitive molecular-based detection methods specific to both viroids are available. Both diseases are controlled by using viroids-free budwoods for new plantations, launching budwood certification programs, and establishing a quarantine system for new citrus varieties introduction. The most important achievements in CEVd and HSVd researches are outlined in this chapter. This would help to provide a clearer understanding of the diseases they cause and contribute to the development of better control strategies.