First Report of Phaeoacremonium mortoniae Associated with Grapevine Decline in Iran

In July 2009, a survey was conducted in individually owned rooted vineyards in Iran to determine fungal pathogens associated with grapevine decline. Symptoms of grapevine decline such as slow dieback, stunted growth, small chlorotic leaves, and reduced foliage were observed on 7-year-old grapevines (cv. Askari) in Bavanat (Fars Province, southwestern Iran). Internal wood symptoms such as black spots and dark brown-to-black vascular streaking were observed in cross and longitudinal sections of stems and trunks. Wood samples were collected from symptomatic trunks and cordons. The bark of each fragment was removed and 10 thin cross sections (2 to 3 mm thick) were cut from symptomatic vascular tissue of the samples. These disks were immersed in 1.5% sodium hypochlorite solution for 4 min, washed thrice with sterile distilled water, and plated onto malt extract agar (MEA) supplemented with 100 mg liter–1 of streptomycin sulfate. Plates were incubated at 25°C in darkness. All colonies were transferred to potato dextrose agar (PDA) and incubated at 25°C. Five isolates of a Phaeoacremonium sp. were obtained. Single-spore isolates were transferred to PDA, MEA, and oatmeal agar (OA) media and incubated at 25°C for 8 to 16 days in the dark (2). Colonies reached a radius of 9.5 to 12 mm after 8 days of incubation. Colonies were flat and yellowish white on PDA and OA and white-to-pale gray after 16 days of incubation on MEA. Conidiophores were short and unbranched, 14 to 38.5 (23.5) μm long, and often ending in a single terminal phialide. Phialides were terminal or lateral and mostly monophialidic. Conidia were hyaline, oblong to ellipsoidal or reniform, 2 to 6.5 (4.9) μm long, and 1.1 to 1.7 (1.4) μm wide. On the basis of these characteristics, the isolates were identified as Phaeoacremonium mortoniae (1,2). Additionally, identity of the PMH1 isolate was confirmed by sequencing a fragment of the -tubulin gene with primers T1 and Bt2b (GenBank Accession No. JF831449). The sequence of this isolate was identical to the sequence of P. mortoniae (GenBank Accession No. HM116767). Pathogenicity tests were conducted on 2-month-old grapevine seedlings of cv. Askari by watering the roots with 25 ml of a conidial suspension (107 conidia ml–1) harvested from 21-day-old cultures grown on MEA. Controls were inoculated with 25 ml of sterile distilled water. Fifteen replicates were used for each isolate with an equal number of noninoculated plants. All plants were grown under greenhouse conditions (25 to 30°C). Two months after inoculation, inoculated seedlings showed reduced growth, chlorotic leaves, epinasty, severe defoliation, and finally wilting, while control seedlings remained healthy. The fungus was reisolated from internal tissues of the stems of inoculated seedlings. To my knowledge, this is the first report of P. mortoniae causing grapevine decline in Iran. References: (1) M. Groenewald et al. Mycol. Res. 105:651, 2001. (2) L. Mostert et al. Stud. Mycol. 54:1, 2006.

Download Full-text

First Report of Phaeoacremonium mortoniae Causing Petri Disease of Grapevine in Spain

Plant Disease ◽

10.1094/pdis-91-9-1206a ◽

2007 ◽

Vol 91 (9) ◽

pp. 1206-1206 ◽

Cited By ~ 8

Author(s):

D. Gramaje ◽

S. Alaniz ◽

A. Pérez-Sierra ◽

P. Abad-Campos ◽

J. García-Jiménez ◽

...

Keyword(s):

Tap Water ◽

Sodium Hypochlorite Solution ◽

Malt Extract ◽

Distilled Water ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Fungal Isolation ◽

Centraalbureau Voor ◽

First Report ◽

Grapevine Decline

In May 2006, symptoms of grapevine decline were observed on 4-year-old grapevines (cv. Cabernet Sauvignon) grafted onto 110 R rootstock in Daimiel (Ciudad Real Province, central Spain). Affected vines had low vigor, reduced foliage, and chlorotic leaves. Cross or longitudinal sections of the rootstock trunk showed black spots and dark streaking of the xylem vessels. Five symptomatic plants were collected and analyzed for fungal isolation. Sections (10 cm long) were cut from the basal end of the rootstocks, washed under running tap water, surface sterilized for 1 min in a 1.5% sodium hypochlorite solution, and washed twice with sterile distilled water. The sections were split longitudinally and small pieces of discolored tissues were plated onto malt extract agar (MEA) supplemented with 0.5 g L–1 of streptomycin sulfate. Plates were incubated at 25 to 26°C in the dark for 14 to 21 days and all colonies were transferred to potato dextrose agar (PDA). A Phaeoacremonium sp. was consistently isolated from necrotic tissues. Single conidial isolates were obtained and grown on PDA and MEA in the dark at 25°C for 2 to 3 weeks until colonies produced spores (3). Colonies were yellowish white on PDA and white-to-pale gray on MEA. Conidiophores were short and unbranched, 12.5 to 37.5 (20.5) μm long, and often consisting of a single subcylindrical phialide. Conidia were hyaline, oblong to ellipsoidal or reniform, 2.5 to 7.5 (4.6) μm long, and 1.2 to 1.9 (1.6) μm wide. On the basis of these characteristics, the isolates were identified as Phaeoacremonium mortoniae (2,3). Identity of isolate Pmo-1 was confirmed by PCR-restriction fragment length polymorphism of the internal transcribed spacer region (Phaeoacremonium-specific primers Pm1-Pm2) with the restriction enzymes BssKI, EcoO109I, and HhaI (1). Additionally, the β-tubulin gene fragment (primers T1 and Bt2b) of this isolate was sequenced (GenBank Accession No. EF517921). The sequence was identical to the sequence of P. mortoniae (GenBank Accession No. DQ173109). Pathogenicity tests were conducted on 2-month-old grapevine seedlings (cv. Tempranillo) using two isolates, Pmo-1 and a reference isolate of P. mortoniae (CBS-101585) obtained from the Centraalbureau voor Schimmelcultures (Utrecht, the Netherlands). Seedlings were inoculated when two to three leaves had emerged by watering the roots with 25 mL of a conidial suspension (106 conidia mL–1) harvested from 21-day-old cultures grown on PDA. Controls were inoculated with sterile distilled water. There were 20 replicates for each isolate with an equal number of uninoculated plants. Seedlings were maintained in a greenhouse at 23 to 25°C. Within 2 months after inoculation, symptoms developed as reduced growth, chlorotic leaves, severe defoliation, and finally wilting. Control plants did not show any of these symptoms. The fungus was reisolated from internal tissues of the crown area and the stems of all inoculated seedlings, completing Koch's postulates. To our knowledge, this is the first report of P. mortoniae causing young grapevine decline in Spain. References: (1) A. Aroca and R. Raposo. Appl. Environ. Microbiol. 73:2911, 2007. (2) M. Groenewald et al. Mycol. Res. 105:651, 2001. (3) L. Mostert et al. Stud. Mycol. 54:1, 2006.

Download Full-text

First Report of Phaeoacremonium parasiticum Causing Petri Disease of Grapevine in Peru

Plant Disease ◽

10.1094/pdis-93-2-0200b ◽

2009 ◽

Vol 93 (2) ◽

pp. 200-200 ◽

Cited By ~ 2

Author(s):

L. C. Romero-Rivas ◽

L. A. Álvarez ◽

D. Gramaje ◽

J. Armengol ◽

C. Cadenas-Giraldo

Keyword(s):

Restriction Enzymes ◽

Sodium Hypochlorite Solution ◽

Malt Extract ◽

Distilled Water ◽

Internal Transcribed Spacer Region ◽

Poor Growth ◽

First Report ◽

Grapevine Decline ◽

Pathogenicity Tests ◽

Weak Growth

Since 2005, symptoms of grapevine decline have been observed on 4- to 8-month-old grapevines (cvs. Red globe and Crimson) grafted onto 1103 P rootstock in Ica and Pisco valleys in southern Peru. Affected plants exhibited weak growth, interveinal chlorosis, necrosis and wilting of leaves, and death. Dark brown-to-black streaking of the xylem was seen when transverse or longitudinal cuts were made in the trunk and shoots. Symptomatic plants were collected and sections (5 cm long) were cut from the zone between the rootstock and the scion, surface sterilized for 1 min in a 1.5% sodium hypochlorite solution, and washed twice with sterile distilled water. The sections were split longitudinally, and small pieces of discolored tissues were placed onto potato dextrose agar (PDA) supplemented with oxytetracycline (500 mg liter–1). Plates were incubated at 25°C in the dark for 15 days. A Phaeoacremonium sp. was consistently isolated from necrotic tissues. Single conidial isolates were obtained and grown on PDA and malt extract agar (MEA) in the dark at 25°C for 3 weeks until colonies produced spores (3). Colonies were brown on PDA and olive brown on MEA. Conidiophores were branched, 27.5 to 67.5 (42.5) μm long, and often consisting of a single phialide. Conidia were hyaline, oblong ellipsoidal, 2.5 to 4.5 (3.6) μm long, and 1.2 to 1.9 (1.6) μm wide. On the basis of these characteristics, the isolates were identified as Phaeoacremonium parasiticum (Ajello, Georg & C.J.K Wang) W. Gams, Crous & M.J. Wingf. (teleomorph Togninia parasitica L. Mostert, W. Gams & Crous) (2,3). Identity of isolate Ppa-1 was confirmed by PCR-restriction fragment length polymorphism of the internal transcribed spacer region (Phaeoacremonium-specific primers Pm1-Pm2) with the restriction enzymes BssKI, EcoO109I, and HhaI (1). Additionally, the beta-tubulin gene fragment (primers T1 and Bt2b) of this isolate was sequenced (GenBank Accession No. FJ151015). The sequence was identical to the sequence of P. parasiticum (GenBank Accession No. AY328379). Pathogenicity tests were conducted using the isolate Ppa-1. Approximately 20 μl of a suspension containing 103 conidia ml–1 was injected into the pith of four nodes on each of 10 dormant, unrooted, 15 cm long cuttings of cv. Red Globe. Four nodes on each of 10 cuttings were used as controls and injected with an equal volume of sterile distilled water. Inoculation points were covered with Parafilm. The cuttings were planted in plastic pots and maintained at 24 ± 3°C in diffuse light, watering as needed. Within 2 months of inoculation, all P. parasicitum-inoculated cuttings exhibited shoots with very poor growth with small leaves and short internodes. In the xylem vessels, black streaks identical to symptoms observed in declining vines in the vineyard were observed. Control plants did not show any of these symptoms. The fungus was reisolated from internal tissues of symptomatic shoots of all inoculated cuttings but not from the control shoots. To our knowledge, this is the first report of P. parasiticum causing young grapevine decline in Peru. References: (1) A. Aroca and R. Raposo. Appl. Environ. Microbiol. 73:2911, 2007. (2) P. W. Crous et al. Mycology 88:786, 2006. (3) L. Mostert et al. Stud. Mycol. 54:1, 2006.

Download Full-text

First Report of Phaeoacremonium scolyti Causing Petri Disease of Grapevine in Spain

Plant Disease ◽

10.1094/pdis-92-5-0836b ◽

2008 ◽

Vol 92 (5) ◽

pp. 836-836 ◽

Cited By ~ 7

Author(s):

D. Gramaje ◽

S. Alaniz ◽

A. Pérez-Sierra ◽

P. Abad-Campos ◽

J. García-Jiménez ◽

...

Keyword(s):

Tap Water ◽

Restriction Enzymes ◽

Sodium Hypochlorite Solution ◽

Malt Extract ◽

Distilled Water ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Fungal Isolation ◽

First Report ◽

Petri Disease

In May 2007, a survey was conducted to evaluate the phytosanitary status of grapevine propagating materials in a commercial nursery located in Valencia Province (eastern Spain). Fungal isolation was performed on 25 grafted plants (1-year-old grapevines cv. Tempranillo grafted onto 110 R rootstock) because they showed reduced root biomass and black discoloration of the xylem vessels. Sections (10 cm long) were cut from the basal end of the rootstocks, washed under running tap water, surface sterilized for 1 min in a 1.5% sodium hypochlorite solution, and washed twice with sterile distilled water. The sections were split longitudinally and small pieces of discolored tissues were placed onto malt extract agar (MEA) supplemented with streptomycin sulfate (0.5 g L–1). Plates were incubated at 25°C in the dark for 14 to 21 days after which all colonies were transferred to potato dextrose agar (PDA). Togninia minima (Tul. & C. Tul.) Berl. (anamorph Phaeoacremonium aleophilum W. Gams, Crous, M.J. Wingf. & Mugnai) and another Phaeoacremonium sp. were consistently isolated from necrotic tissues. Single conidial isolates of this Phaeoacremonium sp. were grown on PDA and MEA in the dark at 25°C for 2 to 3 weeks until colonies produced spores (3). Colonies were grayish brown on PDA and pinkish white on MEA. Conidiophores were mostly short and unbranched, 15 to 30 (mean 20.8) μm long, often consisting of an elongate-ampuliform phialide. Conidia were hyaline, oblong-ellipsoidal occasionally reniform or allantoid, 2.5 to 5.6 (mean 3.8) μm long, and 1 to 2.1 (mean 1.4) μm wide. On the basis of these characteristics, these isolates were identified as Phaeoacremonium scolyti L. Mostert, Summerb. & Crous (2,3). Identity of isolate Psc-1 was confirmed by PCR-restriction fragment length polymorphism of the internal transcribed spacer region using Phaeoacremonium-specific primers Pm1-Pm2 and restriction enzymes BssKI, EcoO109I, and HhaI (1). Additionally, the β-tubulin gene fragment (primers T1 and Bt2b) of this isolate was sequenced (GenBank Accession No. EU260415). The sequence showed high similarity (98%) with the sequence of P. scolyti (GenBank Accession No. AY579292). Pathogenicity tests were conducted on 2-month-old grapevine seedlings (cv. Tempranillo) using the isolate Psc-1. Ten seedlings were inoculated when two to three leaves had emerged by watering the roots with 25 mL of a conidial suspension (106 conidia mL–1) harvested from 21-day-old cultures grown on PDA. Ten controls plants were inoculated with sterile distilled water. Seedlings were maintained in a greenhouse at 23 to 25°C. Within 2 months of inoculation, symptoms developed on all of the inoculated plants as crown necrosis, chlorotic leaves, severe defoliation, and wilting. Control plants did not show any symptoms. The fungus was reisolated from internal tissues of the crown area and the stems of all inoculated seedlings, completing Koch's postulates. To our knowledge, this is the first report of P. scolyti causing Petri disease in Spain. References: (1) A. Aroca and R. Raposo. Appl. Environ. Microbiol. 73:2911, 2007. (2) L. Mostert et al. J. Clin. Microbiol. 43:1752, 2005. (3) L. Mostert et al. Stud. Mycol. 54:1, 2006.

Download Full-text

First Report of Alternaria tenuissima Causing Postharvest Decay on Apple Fruit from Cold Storage in the United States

Plant Disease ◽

10.1094/pdis-07-13-0802-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 690-690 ◽

Cited By ~ 1

Author(s):

L. P. Kou ◽

V. L. Gaskins ◽

Y. G. Luo ◽

W. M. Jurick

Keyword(s):

United States ◽

South Africa ◽

Cold Storage ◽

Fungal Pathogens ◽

The United States ◽

Apple Fruit ◽

Conidial Suspension ◽

Single Spore ◽

Alternaria Tenuissima ◽

First Report

Apples are grown and stored for 9 to 12 months under controlled atmosphere conditions in the United States. During storage, apples are susceptible to various fungal pathogens, including several Alternaria species (2). Alternaria tenuissima (Nees) Wiltshire causes dry core rot (DCR) on apples during storage and has recently occurred in South Africa (1). Losses range widely, but typically occur at 6 to 8% annually due to this disease (2). In February 2013, ‘Nittany’ apples with round, dark-colored, dry, spongy lesions were obtained from wooden bins in a commercial cold storage facility located in Pennsylvania. Symptomatic fruits were transported to the lab, rinsed with sterile water, and the lesions were sprayed with 70% ethanol until runoff and wiped dry. The skin was aseptically removed with a scalpel, and asymptomatic tissue was placed onto potato dextrose agar (PDA) and incubated at 25°C. Two single-spore isolates were propagated on PDA and permanent cultures were maintained as slants and stored at 4°C. The fungus produced a cottony white mycelium that turned olive-green to brown with abundant aerial hyphae and had a dark brown to black reverse on PDA. Isolates were identified as Alternaria based on conidial morphology as the spores were slightly melanized and obclavate to obpyriform catentulate with longitudinal and transverse septa attached in unbranched chains on simple short conidiophores. Conidia ranged from 10 to 70 μm long (mean 27.7 μm) and 5 to 15 μm wide (mean 5.25 μm) (n = 50) with 1 to 6 transverse and 0 to 2 longitudinal septa. Conidial beaks, when present, were short (5 μm or less) and tapered. Mycelial genomic DNA was extracted, and a portion of the histone gene (357 bp) was amplified via gene specific primers (Alt-His3-F/R) using conventional PCR (Jurick II, unpublished). The forward and reverse sequences were assembled into a consensus representing 2× coverage and MegaBLAST analysis showed that both isolates were 100% identical to Alternaria tenuissima isolates including CR27 (GenBank Accession No. AF404622.1) that caused DCR on apple fruit during storage in South Africa. Koch's postulates were conducted using 10 organic ‘Gala’ apple fruit that were surface sterilized with soap and water, sprayed with 70% ethanol, and wiped dry. The fruit were aseptically wounded with a nail to a 3 mm depth, inoculated with 50 μl of a conidial suspension (1 × 104 conidia/ml), and stored at 25°C in 80 count boxes on paper trays for 21 days. Mean lesion diameters on inoculated ‘Gala’ apple fruit were 19.1 mm (±7.4), water only controls (n = 10 fruit) were symptomless, and the experiment was repeated. Symptoms observed on artificially inoculated ‘Gala’ apple fruit were similar to the decay observed on ‘Nittany’ apples from cold storage. Based on our findings, it is possible that A. tenuissima can cause decay that originates from wounded tissue in addition to dry core rot, which has been reported (1). Since A. tenuissima produces potent mycotoxins, even low levels of the pathogen could pose a health problem for contaminated fruit destined for processing and may impact export to other countries. To the best of our knowledge, this is the first report of alternaria rot caused by A. tenuissima on apple fruit from cold storage in the United States. References: (1) J. C. Combrink et al. Decid. Fruit Grow. 34:88, 1984. (2) M. Serdani et al. Mycol. Res. 106:562, 2002. (3) E. E. Stinson et al. J. Agric. Food Chem. 28:960, 1980.

Download Full-text

First Report of Walnut Canker Caused by Fusarium incarnatum from India

Plant Disease ◽

10.1094/pdis-04-11-0352 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1587-1587

Author(s):

B. Singh ◽

C. S. Kalha ◽

V. K. Razdan ◽

V. S. Verma

Keyword(s):

Fusarium Species ◽

Juglans Regia ◽

Infected Plant ◽

Distilled Water ◽

Conidial Suspension ◽

State University ◽

Single Spore ◽

Jammu And Kashmir ◽

First Report ◽

Branch Dieback

While screening newly introduced cultivars of walnut (Juglans regia) at Bhaderwah (Mini Kashmir), Jammu and Kashmir, India in September 2008, 60% of grafted plants were found to be dying because of a cankerous growth observed on seedling stems. Later, these symptoms extended to lateral branches. In the surveyed nurseries, cvs. SKU 0002 and Opex Dachaubaria were severely affected by the disease. Cankers were also observed in all walnut nurseries in the area with several wild seedlings also being observed to be exhibiting similar cankerous symptoms on stem and branches. Necrotic lesions from cankerous tissues on seedling stems were surface disinfested with 0.4% NaOCl for 1 min and these disinfected cankerous tissues were grown on potato dextrose agar (potato-250 g, dextrose-15 g, agar-15 g, distilled water-1 liter). A Fusarium sp. was isolated consistently from these cankerous tissues, which was purified using single-spore culture. Carnation leaf agar was used for further culture identification (2,3). The fungal colony was floccose, powdery white to rosy in appearance when kept for 7 days at 25 ± 2°C. Macroconidia were straight to slightly curved, four to eight septate and 30 to 35 × 3.5 to 5.7 μm. These are characteristics consistent with Fusarium incarnatum (3). Pathogenicity was confirmed by spraying a conidial suspension (1 × 106 conidia/ml) onto bruised branches of 1-year-old walnut plants (cv. Opex Dachaubaria) while sterile distilled water sprays were used for the controls. Inoculated plants were incubated at 20 ± 2°C and 85% relative humidity for 48 h. Fifty days following inoculation, branch dieback followed by canker symptoms developed on inoculated plants. Control plants remained healthy with no symptoms of canker. F. incarnatum (Roberge) Sacc. was repeatedly isolated from inoculated walnut plants, thus satisfying Koch's postulates. Infected plant material has been deposited at Herbarium Crytogamae Indiae Orientalis (ITCC-6874-07), New Delhi. To our knowledge, this is the first report of walnut canker caused by F. incarnatum (Roberge) Sacc. from India. This fungus was previously reported to be affecting walnut in Italy (1) and Argentina (4). References: (1) A. Belisario et al. Informatore Agrario 21:51, 1999. (2) J. C. Gilman. A Manual of Soil Fungi. The Iowa State University Press, Ames, 1959. (3) P. E. Nelson et al. Fusarium Species. An Illustrated Manual for Identification. The Pennsylvania State University Press, University Park, 1983. (4) S. Seta et al. Plant Pathol. 53:248, 2004.

Download Full-text

First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida

Plant Disease ◽

10.1094/pdis-91-7-0905b ◽

2007 ◽

Vol 91 (7) ◽

pp. 905-905 ◽

Cited By ~ 7

Author(s):

H. K. Yun ◽

C. Louime ◽

J. Lu

Keyword(s):

United States ◽

Pcr Primers ◽

The United States ◽

Causal Agent ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Elsinoe Ampelina ◽

Muscadine Grapes

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text

First Report of Colletotrichum acutatum sensu lato Causing Leaf Curling and Petiole Anthracnose on Celery (Apium graveolens) in Michigan

Plant Disease ◽

10.1094/pdis-05-12-0456-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1383-1383 ◽

Cited By ~ 2

Author(s):

L. M. Rodriguez-Salamanca ◽

T. B. Enzenbacher ◽

J. M. Byrne ◽

C. Feng ◽

J. C. Correll ◽

...

Keyword(s):

Its Region ◽

Apium Graveolens ◽

Colletotrichum Acutatum ◽

Fluorescent Light ◽

Post Inoculation ◽

Malt Extract ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Leaf Curling

In September 2010, celery plants with leaf cupping and petiole twisting were observed in commercial production fields located in Barry, Kent, Newago, and Van Buren Counties in Michigan. Long, elliptical lesions were observed on petioles but signs (mycelia, conidia, or acervuli) were not readily observed. Celery petioles were incubated in humid chambers (acrylic boxes with wet paper towels). After 24 h, conidia corresponding to the genus Colletotrichum were observed. Isolations were performed by excising pieces of celery tissue from the lesion margin and placing them on potato dextrose agar (PDA) amended with 30 ppm of rifampicin and 100 ppm of ampicillin. Plates were incubated at 21 ± 2°C under fluorescent light for 5 days. Fungal colony morphology was gray with salmon-colored masses of spores when viewed from above, and carmine when viewed from below. Isolates were single-spored and placed on 30% glycerol in –20°C, and cryoconservation media (20% glycerol, 0.04% yeast extract, 0.1% malt extract, 0.04% glucose, 0.02% K2HPO4) at –80°C. Conidia were 8.5 to 12.0 × 2.8 to 4.0 μm and straight fusiform in shape. Three isolates were confirmed as C. acutatum sensu lato based on sequences of the internal transcribed spacer (ITS) region of the nuclear ribosomal RNA and the 1-kb intron of the glutamine synthase gene (3), both with 100% similarity with Glomerella acutata sequences. Sequences were submitted to GenBank (Accession Nos. JQ951599 and JQ951600 for ITS and GS, respectively). Additionally, C. acutatum specific primer CaIntg was used in combination with the primer ITS4 on 54 isolates from symptomatic celery plants, obtaining the expected 490-pb fragment (1). Koch's postulates were completed by inoculating 4-week-old celery seedlings of cultivars Sabroso, Green Bay, and Dutchess using three plants per cultivar. Prior to inoculation, seedlings were incubated for 16 h in high relative humidity (≥95%) by enclosing the plants in humid chambers. Seven-day-old C. acutatum s. l. colonies were used to prepare the inoculum. Seedlings were spray-inoculated with a C. acutatum s. l. conidial suspension of 1 × 106 conidia/ml in double-distilled water plus Tween 0.01%. Two control seedlings per cultivar were sprayed with sterile, double-distilled water plus 0.01% Tween. Plants were enclosed in bags for 96 h post inoculation and incubated in a greenhouse at 27°C by day/20°C by night with a 16-h photoperiod. Leaf curling was observed on all inoculated plants of the three cultivars 4 days after inoculation (DAI). Petiole lesions were observed 14 to 21 DAI. Conidia were observed in lesions after incubation in high humidity at 21 ± 2°C for 24 to 72 h. Symptomatic tissue was excised and cultured onto PDA and resulted in C. acutatum colonies. Control plants remained symptomless. C. acutatum (4) and C. orbiculare (2) were reported to cause celery leaf curl in Australia in 1966 (2,4). To our knowledge, this is the first report of C. acutatum s. l. infecting celery in Michigan. References: (1) A. E. Brown et al. Phytopathology 86:523, 1996. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., USDA-ARS. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 10 September 2010. (3) J. C. Guerber et al. Mycologia 95:872, 2003. (4) D. G. Wright and J. B. Heaton. Austral. Plant Pathol. 20:155, 1991.

Download Full-text

First Report of Brown Rot Caused by Monilinia fructicola on Apple in Italy

Plant Disease ◽

10.1094/pdis-09-12-0869-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 689-689 ◽

Cited By ~ 6

Author(s):

C. Martini ◽

A. Spadoni ◽

M. Mari

Keyword(s):

Fungal Pathogens ◽

Brown Rot ◽

Its2 Region ◽

Monilinia Fructicola ◽

Malt Extract ◽

Conidial Suspension ◽

First Report ◽

Molecular Features ◽

Sterile Needle ◽

Emilia Romagna Region

Monilinia fructicola (G. Wint.) Honey, the causal agent of brown rot, is one of the most important fungal pathogens of stone fruit but may also affect pome fruits. The pathogen is common in North America, Oceania, South America, and Asia. It is a quarantined pathogen in Europe (3), but was recently detected in apple from the Czech Republic, Germany, and Serbia (1,2,4). In January 2012, during a survey for fungal postharvest pathogens, stored apple (Malus domestica Borkh.) belonging to the cultivars Gala and Pink Lady showing brown rot symptoms were observed in the Emilia Romagna region, Italy. Typical decay spots were circular and brown, tending toward black. Decayed tissues remained firm, and numerous grayish pustules containing spores appeared on rotted areas. The pathogen was isolated on V8 juice agar and culture plates were incubated at 25°C in darkness for 5 days. A conidial suspension was spread on malt extract agar and single spores were selected. The colonies were morphologically identified as M. fructigena. Two colonies developing a gray mass of spores in concentric rings with the reverse side black were further studied by molecular tools. The colony margins were even and the conidia were one-celled, limoniform, hyaline, and 12.1 to 17.4 × 8.4 to 11.2 μm. The ribosomal ITS1-5.8S-ITS2 region was PCR-amplified from genomic DNA obtained from mycelium using primers ITS1 and ITS4. A BLAST search in GenBank revealed the highest similarity (99%) to M. fructicola sequences (GenBank Accession Nos. HQ893748.1 and FJ515894.1). Pathogenicity was confirmed using surface-sterilized mature ‘Gala’ apples, wounded with a sterile needle, and inoculated with an isolate conidial suspension (103 spores/ml). A 20 μl droplet was placed in the wound; control fruits received sterile water without conidia. After 5 days of incubation at 20°C in plastic containers with high humidity, typical symptoms of brown rot developed on inoculated fruits, while control fruits remained symptomless. The fungus isolated from inoculated fruit exhibited the same morphological and molecular features shown by the original isolates. To our knowledge, this is the first report of the fungus M. fructicola on apple in Italy. Further studies are necessary to determine geographic distribution, prevalence and economic importance of this quarantine organism in Italy. References: (1) J. Duchoslavovà et al. Plant Dis.91:907, 2007. (2) A. Grabke et al. Plant Dis. 95:772, 2011. (3) OEPP/EPPO. EPPO A2 list of pests recommended for regulation as quarantine pests. Version 2010-09. Retrieved from http://www.eppo.int/QUARANTINE/listA2.htm , 2010. (4) M. Vasic et al. Plant Dis. 96:456, 2012.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing wilt disease of Phaseolus vulgaris in Mexico

Plant Disease ◽

10.1094/pdis-06-20-1160-pdn ◽

2020 ◽

Author(s):

José Francisco Díaz-Nájera ◽

Sergio Ayvar-Serna ◽

Antonio Mena-Bahena ◽

Emiliano Baranda-Cruz ◽

Mateo Vargas-Hernández ◽

...

Keyword(s):

Phaseolus Vulgaris ◽

Tap Water ◽

Wilt Disease ◽

Healthy Plant ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Fusarium Falciforme

Bean (Phaseolus vulgaris) is the second most important crop in Mexico after corn due to the high consumption of beans in all regions of the country. In the winter (January 2016), bean plants showing wilting, root discoloration and necrosis were observed, with an incidence of approximately 30% in different fields (<1 ha) in Tecoanapa, Guerrero State, Mexico. Symptomatic fine roots (<2 mm) were cut into 0.5 cm long pieces, washed with tap-water, surface disinfected with 1.5% NaOCl for 3 min, and rinsed with sterile distilled water. Thirty-five pieces were placed on potato dextrose agar (PDA, Difco) and incubated at 25 ℃ for seven days. Then, single-spore isolates were obtained. Colonies on PDA showed abundant white aerial mycelium and a growth rate of 4.5 mm/day, and in reverse, colonies were white/pink with a brown centre. Microconidia were cylindrical to ellipsoid, aseptate, hyaline and 7.8-(6.0)-4.7 × 2.7-(2.1)-1.6 µm. On carnation leaf agar, macroconidia were 37.8-(29.4)-23.5 × 4.1-(3.5)-2.6 µm, hyaline, falcate, with slightly curved apexes, and 3-5 septa. Chlamydospores were round, intercalary, hyaline, single or in chains (Boot 1971). A representative strain (CSAEGRO-AyDi-Ef) was analyzed by PCR and the translation elongation factor 1-alpha (tef1) gene (GenBank accession number MK945757) was sequenced using the EF-1/EF-2 primers (O’Donnell 2000). FUSARIUM-ID (Geiser et al. 2004) analysis showed 100% similarity with the Fusarium solani species complex (FSSC 3+4) strain NRRL28562. In addition, Bayesian phylogenetic analysis placed this strain in the Fusarium falciforme clade. A pathogenicity test was performed by immersing healthy plant roots (cv. Negro Jamapa) in 200 mL of a conidial suspension (50×106 conidia mL-1) for 10 min, and then transplanting the plants into pots. Control plants were immersed in sterile distilled water. Similar symptoms as those in the field were observed at 10 days after inoculation, and the controls were healthy. The fungus was reisolated from infected plants and showed the same morphology and tef1 sequence as the original isolate, fulfilling Koch’s postulates. Recently, F. falciforme was reported to cause wilting of P. vulgaris in Cuba (Duarte et al. 2019); however, this is the first report of F. falciforme (FSSC 3+4) causing wilt disease of P. vulgaris in Mexico. This species was previously reported in Mexico affecting onion (Tirado-Ramírez et al. 2018), papaya, tomato (Vega-Gutiérrez et al. 2019a, b), and maize (Douriet-Angulo et al. 2019), suggesting an ample host range in the country.

Download Full-text

First Report of Alternaria Black Spot of Pomegranate Caused by Alternaria alternata in Spain

Plant Disease ◽

10.1094/pdis-07-13-0717-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 689-689 ◽

Cited By ~ 8

Author(s):

M. Berbegal ◽

I. López-Cortés ◽

D. Salazar ◽

D. Gramaje ◽

A. Pérez-Sierra ◽

...

Keyword(s):

Black Spot ◽

Fungal Isolate ◽

Sodium Hypochlorite Solution ◽

Conidial Suspension ◽

Sterile Water ◽

Single Spore ◽

Beta Tubulin ◽

Transparent Plastic ◽

First Report ◽

Black Spots

Since 2010, a new foliar and fruit disease was observed in pomegranate (Punica granatum L.) orchards in Alicante Province (eastern Spain). Symptoms included black spots on leaves and fruits, as well as chlorosis and premature abscission of leaves. Fungal isolates were obtained by surface-disinfecting small fragments of symptomatic leaf and fruit tissues in 0.5% NaOCl, double-rinsing in sterile water, and plating them onto potato dextrose agar (PDA) amended with 0.5 g/liter of streptomycin sulfate. Gray-to-black colonies were obtained, which were identified as Alternaria sp. based on the dark, brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (4). Conidia (n = 100) measured (12.2-) 20.2 (-27.6) × (5.7-) 9.2 (-12.0) μm, and had 3 to 6 transverse and 0 to 5 longitudinal septa. Single spore cultures were obtained and their genomic DNA was extracted. The internal transcribed spacer (ITS) region of rDNA and partial sequences of the beta tubulin gene were amplified and sequenced with primers ITS1-ITS4 and Bt1a-Bt1b, respectively (3). BLAST analysis of the sequences showed that they were 100% identical to a pathogenic A. alternata (Fr.) Keissl. isolate obtained from black spot disease of pomegranate in Israel (Accession No. JN247826.1, ITS and Accession No. JN247836.1, beta tubulin) (2). As all the sequences obtained showed 100% homology, ITS and beta tubulin sequences of a representative isolate (1516B) were submitted to GenBank (KF199871 and KF199872, respectively). In addition, a PCR reaction with specific primers (C_for/C_rev) designed to recognize highly virulent isolates of A. alternata causing black spot of pomegranate was used with all isolates (2). A characteristic fragment of ~950 bp was amplified in two isolates: 1552B and 1707B. Pathogenicity was assessed on plants and detached fruit of pomegranate cv. Mollar (1). Two-year-old pomegranate trees were inoculated with isolates 1552B and 1707B by spraying a conidial suspension (106 conidia/ml) onto the upper and lower leaf surfaces. Five plants per fungal isolate were used and five control plants were sprayed with sterile water. Plants were covered with transparent plastic bags and incubated in a growth chamber for 1 month at 25°C, with a 12-h photoperiod. One-month-old fruits were surface sterilized in 1.5% sodium hypochlorite solution for 1 min and rinsed twice in water. Two filter paper squares (5 × 5 mm) were dipped in the conidial suspensions and placed on the fruit surface. Inoculated fruit were incubated in a humid chamber in the dark at 25°C. Ten fruit per fungal isolate were used and 10 control fruit were inoculated with sterile water. Black spots were visible on inoculated leaves and fruit, 10 and 3 days after inoculation, respectively. Symptoms were not observed on controls. The fungus was re-isolated from leaf and fruit lesions, confirming Koch's postulates. Leaf black spot of pomegranate caused by A. alternata was first described in India in 1988, and later in Israel in 2010 affecting both fruit and leaves (1). To our knowledge, this is the first report of the disease in Spain, where it could represent a threat for pomegranate cultivation due to the increasing amount of area dedicated to this crop. References: (1) D. Ezra et al. Australas. Plant Dis. Notes 5:1, 2010. (2) T. Gat et al. Plant Dis. 96:1513, 2012. (3) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (4) E. G. Simmons. Alternaria: An identification manual. CBS Fungal Biodiversity Center, Utrecht, Netherlands, 2007.

Download Full-text