First report of Fusarium falciforme (FSSC 3+4) causing wilt disease of Phaseolus vulgaris in Mexico

Bean (Phaseolus vulgaris) is the second most important crop in Mexico after corn due to the high consumption of beans in all regions of the country. In the winter (January 2016), bean plants showing wilting, root discoloration and necrosis were observed, with an incidence of approximately 30% in different fields (<1 ha) in Tecoanapa, Guerrero State, Mexico. Symptomatic fine roots (<2 mm) were cut into 0.5 cm long pieces, washed with tap-water, surface disinfected with 1.5% NaOCl for 3 min, and rinsed with sterile distilled water. Thirty-five pieces were placed on potato dextrose agar (PDA, Difco) and incubated at 25 ℃ for seven days. Then, single-spore isolates were obtained. Colonies on PDA showed abundant white aerial mycelium and a growth rate of 4.5 mm/day, and in reverse, colonies were white/pink with a brown centre. Microconidia were cylindrical to ellipsoid, aseptate, hyaline and 7.8-(6.0)-4.7 × 2.7-(2.1)-1.6 µm. On carnation leaf agar, macroconidia were 37.8-(29.4)-23.5 × 4.1-(3.5)-2.6 µm, hyaline, falcate, with slightly curved apexes, and 3-5 septa. Chlamydospores were round, intercalary, hyaline, single or in chains (Boot 1971). A representative strain (CSAEGRO-AyDi-Ef) was analyzed by PCR and the translation elongation factor 1-alpha (tef1) gene (GenBank accession number MK945757) was sequenced using the EF-1/EF-2 primers (O’Donnell 2000). FUSARIUM-ID (Geiser et al. 2004) analysis showed 100% similarity with the Fusarium solani species complex (FSSC 3+4) strain NRRL28562. In addition, Bayesian phylogenetic analysis placed this strain in the Fusarium falciforme clade. A pathogenicity test was performed by immersing healthy plant roots (cv. Negro Jamapa) in 200 mL of a conidial suspension (50×106 conidia mL-1) for 10 min, and then transplanting the plants into pots. Control plants were immersed in sterile distilled water. Similar symptoms as those in the field were observed at 10 days after inoculation, and the controls were healthy. The fungus was reisolated from infected plants and showed the same morphology and tef1 sequence as the original isolate, fulfilling Koch’s postulates. Recently, F. falciforme was reported to cause wilting of P. vulgaris in Cuba (Duarte et al. 2019); however, this is the first report of F. falciforme (FSSC 3+4) causing wilt disease of P. vulgaris in Mexico. This species was previously reported in Mexico affecting onion (Tirado-Ramírez et al. 2018), papaya, tomato (Vega-Gutiérrez et al. 2019a, b), and maize (Douriet-Angulo et al. 2019), suggesting an ample host range in the country.

Download Full-text

First Report of Corynespora Leaf Spot of Eucalyptus in China

Plant Disease ◽

10.1094/pdis-07-14-0697-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 419-419 ◽

Cited By ~ 1

Author(s):

C. K. Phan ◽

J. G. Wei ◽

F. Liu ◽

B. S. Chen ◽

J. T. Luo ◽

...

Keyword(s):

Leaf Spot ◽

Southern China ◽

Tap Water ◽

Pathogenic Fungi ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Eucalyptus is widely planted in the tropics and subtropics, and it has become an important cash crop in Southern China because of its fast-growing nature. In the Guangxi Province of southern China, Eucalyptus is produced on approximately 2 million ha, and two dominant asexual clones, Guanglin No. 9 (E. grandis × E. urophylla) and DH3229 (E. urophylla × E. grandis), are grown. Diseases are an increasing threat to Eucalyptus production in Guangxi since vast areas are monocultured with this plant. In June 2013, a leaf spot disease was observed in eight out of 14 regions in the province on a total of approximately 0.08 million ha of Eucalyptus. Initially, the lesions appeared as water-soaked dots on leaves, which then became circular or irregular shaped with central gray-brown necrotic lesions and dark red-brown margins. The size of leaf spots ranged between 1 and 3 mm in diameter. The main vein or small veins adjacent to the spots were dark. The lesions expanded rapidly during rainy days, producing reproductive structures. In severe cases, the spots coalesced and formed large irregular necrotic areas followed by defoliation. The causal fungus was isolated from diseased leaves. Briefly, the affected leaves were washed with running tap water, sterilized with 75% ethanol (30 s) and 0.1% mercuric dichloride (3 min), and then rinsed three times with sterilized water. Small segments (0.5 to 0.6 cm2) were cut from the leading edge of the lesions and plated on PDA. The plates were incubated at 25°C for 7 to 10 days. When mycelial growth and spores were observed, a single-spore culture was placed on PDA and grown in the dark at 25°C for 10 days. A pathogenicity test was done by spraying a conidial suspension (5 × 105 conidia ml–1) of isolated fungus onto 30 3-month-old leaves of Guanglin No. 9 seedlings. The plants were covered with plain plastic sheets for 7 days to keep the humidity high. Lesions similar to those observed in the forests were observed on the inoculated leaves 7 to 10 days after incubation. The same fungus was re-isolated. Leaves of control plants (sprayed with sterilized water) were disease free. Conidiophores of the fungus were straight to slightly curved, erect, unbranched, septate, and pale to light brown. Conidia were formed in chains or singly with 4 to 15 pseudosepta, which were oblong oval to cylindrical, subhyaline to pale olivaceous brown, straight to curved, 14.5 to 92.3 μm long, and 3.5 to 7.1 μm wide. The fungus was morphologically identified as Corynespora cassiicola (1). DNA of the isolate was extracted, and the internal transcribed spacer (ITS) region (which included ITS 1, 5.8S rDNA gene of rDNA, and ITS 2) was amplified with primers ITS5 and ITS4. 529 base pair (bp) of PCR product was obtained and sequenced. The sequence was compared by BLAST search to the GenBank database and showed 99% similarity to C. cassiicola (Accession No. JX087447). Our sequence was deposited into GenBank (KF669890). The biological characters of the fungus were tested. Its minimum and maximum growth temperatures on PDA were 7 and 37°C with an optimum range of 25 to 30°C. At 25°C in 100% humidity, 90% of conidia germinated after 20 h. The optimum pH for germination was 5 to 8, and the lethal temperature of conidia was 55°C. C. cassiicola has been reported causing leaf blight on Eucalyptus in India and Brazil (2,3) and causing leaf spot on Akebia trifoliate in Guangxi (4). This is the first report of this disease on Eucalyptus in China. References: (1) M. B. Ellis and P. Holliday. CMI Descriptions of Pathogenic Fungi and Bacteria, No. 303. Commonwealth Mycological Institute, Kew, Surrey, UK, 1971. (2) B. P. Reis, et al. New Dis. Rep. 29:7, 2014. (3) K. I. Wilson and L. R. Devi. Ind. Phytopathol. 19:393, 1966. (4) Y. F. Ye et al. Plant Dis. 97:1659, 2013.

Download Full-text

First report of Fusarium solani associated with the bulb rot of Tulip (Tulipa spp) in India

Plant Disease ◽

10.1094/pdis-05-21-0916-pdn ◽

2021 ◽

Author(s):

Qadrul Nisa ◽

Efath Shahnaz ◽

Saba Banday ◽

Ali Anwar ◽

Khalid Z Masoodi ◽

...

Keyword(s):

Fusarium Solani ◽

Indian Subcontinent ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

The World ◽

Bulb Rot ◽

Tulip Bulbs

Tulip is an ornamental bulbous flowering crop belonging to the Genus Tulipa and family Liliaceae. It is the first ranking bulbous ornamental plant in the world (Nayeem and Qayoom 2015). They are often the first flowers to witness the bloom in the spring. Kashmir valley is located in northern Himalayas in northwestern region of Indian subcontinent. It is the most alluring and fascinating place all over India and the home of famous “Indhra Gandhi Memorial Tulip garden”, the largest tulip garden in the entire Asia. However there are number of constraints in tulip cultivation among which bulb rot occupy a prominent place (Piwoni 2000). Bulb rot is posing problem to all the tulip growers throughout the world (De Hertogh et al. 1983). Rot symptoms were observed on tulip bulbs in field as well as in storage conditions (20-22◦C temperature with a relative humidity of 65%) in the summers of 2018 and 2019 in Shalimar fields of Kashmir. The main disease symptoms are yellow sunken spots on bulbs, purple-yellow coloration of leaves. Causal agent was isolated using tissue bit technique (Pathak 1972) on potato dextrose agar plates which where incubated at 24±2◦C . Single spore technique was used to obtain the pure isolate (Johnston and Booth 1983). The isolate covered the full plate (90mm) in ten days. The colony was dull whitish in color, flat and smooth with concentric ring formation in the culture plate with inner ring having a creamy exudation. The mycelium was septate, branched and hyaline in color and measured 3.50-5.20 µm in width with an average of 4.4 µm. Micro-conidia were hyaline, cylindrical to oval, 0-1 septa and measured 7.50-11.00×2.80-3.75 µm in size. Macro conidia were hyaline with 3-4 septa, fusiform, moderately curved which measured 21.15- 32.00×3.80-4.75 µm in size with an average of 28.50±0.21× 4.30±0.2 µm. On the basis of these morphological and cultural characteristics of the fungus, it was identified as Fusarium solani (Mar.) Sacc.,. To confirm the identity the PCR amplification was carried out for two genes Internal Transcribed Spacer (ITS 1, ITS 4)and Translation Elongation factor1-alpha gene (tef1- alpha) (O’Donnell et al. 1998; White et al. 1990). BLAST analysis of the sequence obtained for both the genes showed 99% homology with F. solani sequences in GenBank and Fusarium –ID databases. The sequences were deposited in the GenBank (Accession No MN611433, MW995477). Pathogenicity test was conducted on variety orange emperor both in laboratory and polyhouse. Bulbs were divided into three sets, (three bulbs per set) one set was given injury and dipped in conidial suspension (106 conidia/ml) for 30 min, another set was kept uninjured and dipped in spore suspension of same concentration, the third set was served as control and dipped in sterilized distilled water. All the respective sets were incubated in a moist chamber maintained at a temperature of 22 ◦C to observe symptoms. The injured ones showed symptoms after 7-8 days of inoculation, whereas the uninjured bulbs showed symptoms after 11-12 days. No symptoms were observed in controlled set. A pot experiment was also conducted to carry the pathogenicity tests. Bulbs were injured with the help of sterile needle and were dipped in conidial suspension (106 conidia/ml) for 30 min (Pastrana et al. 2014). The bulbs kept for control were dipped in sterilized distilled water. Bulbs were then planted in pots maintained at 18◦C. The above ground parts of the inoculated bulbs showed symptoms like stunted growth which gradually turned yellow and did not produced flowers. The bulbs after harvesting were rotten .No symptoms were observed in controlled plants. To fulfill the Koch's postulates the fungal pathogen was re-isolated which was identified as F. solani. The pathogen is reported to cause disease in other crops (Gupta et al. 2012) but to our knowledge and on the basis of literature, this is the first report of F. solani causing bulb rot of tulip in India.

Download Full-text

First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽

10.1094/pdis-01-14-0060-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1580-1580 ◽

Cited By ~ 2

Author(s):

C. Kithan ◽

L. Daiho

Keyword(s):

Leaf Surface ◽

Agricultural Research ◽

Disease Incidence ◽

Indian Agricultural Research Institute ◽

Mountain Range ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

Download Full-text

First Report of Ramularia coleosporii causing Leaf Spot on Perilla frutescens in Korea

Plant Disease ◽

10.1094/pdis-01-21-0223-pdn ◽

2021 ◽

Author(s):

Md Aktaruzzaman ◽

Tania Afroz ◽

Hyo-Won Choi ◽

Byung Sup Kim

Keyword(s):

Leaf Spot ◽

Ipomoea Batatas ◽

Rust Fungus ◽

Morphological Characteristics ◽

Perilla Frutescens ◽

Herbaceous Plant ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Perilla (Perilla frutescens var. japonica), a member of the family Labiatae, is an annual herbaceous plant native to Asia. Its fresh leaves are directly consumed and its seeds are used for cooking oil. In July 2018, leaf spots symptoms were observed in an experimental field at Gangneung-Wonju National University, Gangneung, Gangwon province, Korea. Approximately 30% of the perilla plants growing in an area of about 0.1 ha were affected. Small, circular to oval, necrotic spots with yellow borders were scattered across upper leaves. Masses of white spores were observed on the leaf underside. Ten small pieces of tissue were removed from the lesion margins of the lesions, surface disinfected with NaOCl (1% v/v) for 30 s, and then rinsed three times with distilled water for 60 s. The tissue pieces were then placed on potato dextrose agar (PDA) and incubated at 25°C for 7 days. Five single spore isolates were obtained and cultured on PDA. The fungus was slow-growing and produced 30-50 mm diameter, whitish colonies on PDA when incubated at 25ºC for 15 days. Conidia (n= 50) ranged from 5.5 to 21.3 × 3.5 to 5.8 μm, were catenate, in simple or branched chains, ellipsoid-ovoid, fusiform, and old conidia sometimes had 1 to 3 conspicuous hila. Conidiophores (n= 10) were 21.3 to 125.8 × 1.3 to 3.6 μm in size, unbranched, straight or flexuous, and hyaline. The morphological characteristics of five isolates were similar. Morphological characteristics were consistent with those described for Ramularia coleosporii (Braun, 1998). Two representative isolates (PLS 001 & PLS003) were deposited in the Korean Agricultural Culture Collection (KACC48670 & KACC 48671). For molecular identification, a multi-locus sequence analysis was conducted. The internal transcribed spacer (ITS) regions of the rDNA, partial actin (ACT) gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified using primer sets ITS1/4, ACT-512F/ACT-783R and gpd1/gpd2, respectively (Videira et al. 2016). Sequences obtained from each of the three loci for isolate PLS001 and PLS003 were deposited in GenBank with accession numbers MH974744, MW470869 (ITS); MW470867, MW470870 (ACT); and MW470868, MW470871 (GAPDH), respectively. Sequences for all three genes exhibited 100% identity with R. coleosporii, GenBank accession nos. GU214692 (ITS), KX287643 (ACT), and 288200 (GAPDH) for both isolates. A multi-locus phylogenetic tree, constructed by the neighbor-joining method with closely related reference sequences downloaded from the GenBank database and these two isolates demonstrated alignment with R. coleosporii. To confirm pathogenicity, 150 mL of a conidial suspension (2 × 105 spores per mL) was sprayed on five, 45 days old perilla plants. An additional five plants, to serve as controls, were sprayed with sterile water. All plants were placed in a humidity chamber (>90% relative humidity) at 25°C for 48 h after inoculation and then placed in a greenhouse at 22/28°C (night/day). After 15 days leaf spot symptoms, similar to the original symptoms, developed on the leaves of the inoculated plants, whereas the control plants remained symptomless. The pathogenicity test was repeated twice with similar results. A fungus was re-isolated from the leaf lesions on the inoculated plants which exhibited the same morphological characteristics as the original isolates, fulfilling Koch’s postulates. R. coleosporii has been reported as a hyperparasite on the rust fungus Coleosporium plumeriae in India & Thailand and also as a pathogen infecting leaves of Campanula rapunculoides in Armenia, Clematis gouriana in Taiwan, Ipomoea batatas in Puerto Rico, and Perilla frutescens var. acuta in China (Baiswar et al. 2015; Farr and Rossman 2021). To the best of our knowledge, this is the first report of R. coleosporii causing leaf spot on P. frutescens var. japonica in Korea. This disease poses a threat to production and management strategies to minimize leaf spot should be developed.

Download Full-text

First Report of Colletotrichum boninense Causing Anthracnose on Pepper in China

Plant Disease ◽

10.1094/pdis-04-12-0403-pdn ◽

2013 ◽

Vol 97 (1) ◽

pp. 138-138 ◽

Cited By ~ 7

Author(s):

Y. Z. Diao ◽

J. R. Fan ◽

Z. W. Wang ◽

X. L. Liu

Keyword(s):

Internal Transcribed Spacer ◽

Severe Disease ◽

Causal Agent ◽

Its Sequences ◽

Universal Primers ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Species Specific

Anthracnose, caused by Colletotrichum spp., is a severe disease and results in large losses in pepper (Capsicum frutescens) production in China (4). Colletotrichum boninense is one of the Colletotrichum species in pepper in China. In August 2011, anthracnose symptoms (circular, sunken lesions with orange to black spore masses) were observed on pepper fruits in De-Yang, Sichuan Province, China. Three single-spore isolates (SC-6-1, SC-6-2, SC-6-3) were obtained from the infected fruits. A 5-mm diameter plug was transferred to potato dextrose agar (PDA); the isolates formed colonies with white margins and circular, dull orange centers. The conidia were cylindrical, obtuse at both ends, and 10.5 to 12.6 × 4.1 to 5.0 μm. The colonies grew rapidly at 25 to 28°C, and the average colony diameter was 51 to 52 mm after 5 days on PDA at 25°C. Based upon these characters, the causal agent was identified as C. boninense. To confirm the identity of the isolates, the internal transcribed spacer (ITS) regions were amplified with the ITS1/ITS4 universal primers (1). The internal transcribed spacer (ITS) sequences (Accession No. JQ926743) of the causal fungus shared 99 to 100% homology with ITS sequences of C. boninense in GenBank (Accession Nos. FN566865 and EU822801). The identity of the causal agent as C. boninense was also confirmed by species-specific primers (Col1/ITS4) (2). In a pathogenicity test, five detached ripe pepper fruits were inoculated with 1 μl of a conidial suspension (106 conidia/mL) or five fruits with 1 μl of sterile water were kept as control. After 7 days in a moist chamber at 25°C, typical anthracnose symptoms had developed on the five inoculated fruits but not on control fruits. C. boninense was reisolated from the lesions, and which was confirmed by morphology and molecular methods as before. There have reports of C. boninense infecting many species of plants, including pepper (3). To our knowledge, this is the first report of C. boninense causing anthracnose on pepper in China. References: (1) A. K. Lucia et al. Phytopathology 93:581, 2002. (2) S. A. Pileggi et al. Can. J. Microbiol. 55:1081, 2009. (3) H. J. Tozze et al. Plant Dis. 93:106, 2009. (4) M. L. Zhang. J. Anhui Agri. Sci. 2:21, 2000.

Download Full-text

First Report of Walnut Canker Caused by Fusarium incarnatum from India

Plant Disease ◽

10.1094/pdis-04-11-0352 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1587-1587

Author(s):

B. Singh ◽

C. S. Kalha ◽

V. K. Razdan ◽

V. S. Verma

Keyword(s):

Fusarium Species ◽

Juglans Regia ◽

Infected Plant ◽

Distilled Water ◽

Conidial Suspension ◽

State University ◽

Single Spore ◽

Jammu And Kashmir ◽

First Report ◽

Branch Dieback

While screening newly introduced cultivars of walnut (Juglans regia) at Bhaderwah (Mini Kashmir), Jammu and Kashmir, India in September 2008, 60% of grafted plants were found to be dying because of a cankerous growth observed on seedling stems. Later, these symptoms extended to lateral branches. In the surveyed nurseries, cvs. SKU 0002 and Opex Dachaubaria were severely affected by the disease. Cankers were also observed in all walnut nurseries in the area with several wild seedlings also being observed to be exhibiting similar cankerous symptoms on stem and branches. Necrotic lesions from cankerous tissues on seedling stems were surface disinfested with 0.4% NaOCl for 1 min and these disinfected cankerous tissues were grown on potato dextrose agar (potato-250 g, dextrose-15 g, agar-15 g, distilled water-1 liter). A Fusarium sp. was isolated consistently from these cankerous tissues, which was purified using single-spore culture. Carnation leaf agar was used for further culture identification (2,3). The fungal colony was floccose, powdery white to rosy in appearance when kept for 7 days at 25 ± 2°C. Macroconidia were straight to slightly curved, four to eight septate and 30 to 35 × 3.5 to 5.7 μm. These are characteristics consistent with Fusarium incarnatum (3). Pathogenicity was confirmed by spraying a conidial suspension (1 × 106 conidia/ml) onto bruised branches of 1-year-old walnut plants (cv. Opex Dachaubaria) while sterile distilled water sprays were used for the controls. Inoculated plants were incubated at 20 ± 2°C and 85% relative humidity for 48 h. Fifty days following inoculation, branch dieback followed by canker symptoms developed on inoculated plants. Control plants remained healthy with no symptoms of canker. F. incarnatum (Roberge) Sacc. was repeatedly isolated from inoculated walnut plants, thus satisfying Koch's postulates. Infected plant material has been deposited at Herbarium Crytogamae Indiae Orientalis (ITCC-6874-07), New Delhi. To our knowledge, this is the first report of walnut canker caused by F. incarnatum (Roberge) Sacc. from India. This fungus was previously reported to be affecting walnut in Italy (1) and Argentina (4). References: (1) A. Belisario et al. Informatore Agrario 21:51, 1999. (2) J. C. Gilman. A Manual of Soil Fungi. The Iowa State University Press, Ames, 1959. (3) P. E. Nelson et al. Fusarium Species. An Illustrated Manual for Identification. The Pennsylvania State University Press, University Park, 1983. (4) S. Seta et al. Plant Pathol. 53:248, 2004.

Download Full-text

First Report of Fusarium proliferatum Causing Fruit Rot of Grapes (Vitis vinifera) in Pakistan

International Journal of Phytopathology ◽

10.33687/phytopath.007.02.2589 ◽

2018 ◽

Vol 7 (2) ◽

pp. 85-88 ◽

Cited By ~ 1

Author(s):

Salman Ghuffar ◽

Gulshan Irshad ◽

Fengyan Zhai ◽

Asif Aziz ◽

Hafiz M. Asadullah M. Asadullah ◽

...

Keyword(s):

Vitis Vinifera ◽

Negative Control ◽

Fusarium Proliferatum ◽

Fruit Rot ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

Fruit Crop ◽

First Report ◽

Thin Walled

Grapes (Vitis vinifera) are the important fruit crop in Pakistan, mostly cultivated for edible purpose. In September 2016, unusual fruit rot symptoms were observed 3-5 days after harvesting on grapes cv. Kishmishi in post-harvest packing houses in Jehlum district (32°56'22.3"N 73°43'31.4"E) of Punjab province. To determine the disease incidence, a total of 10 boxes of grapes from 5 different locations were selected randomly. Each box contained average 12 bunches and 30 bunches out of 120 inspected bunches displayed typical symptoms of the disease. The initial Symptoms were small, round, water-soaked lesions that rapidly developed into soft, white to light pink mycelium near the centre of infected fruits (Figure 1). A total of 186 symptomatic berries were surface sterilized with 1% sodium hypochlorite, rinsed three times with sterile distilled water and dried by placing on filter paper for 45 sec. Sterilized tissues (approximately 4 mm3) were excised and incubated on potato dextrose agar (PDA) medium at 25 ± 4°C. One week after incubation, colonies with abundant aerial mycelium were initially white, cottony and turned to violet and dark purple with age (Figure 2). A total of 25 isolates were examined morphologically. Macroconidia were slender, thin-walled, 3 to 5 septate, curved apical cell, with 20.9 to 45.2 × 3.2 to 7.1 μm and Microconidia were thin-walled, aseptate, club-shaped with 4.5 to 11.2 × 2.3 to 4.1 μm (Figure 3). These characteristics best fit for the description of Fusarium proliferatum (Leslie and Summerell, 2006). Portions of the internal transcribed spacer (ITS) region were sequenced (White et al., 1990). Sequences of two isolates Fus 07 and Fus 09 (GenBank Accessions; MH444366 and MH464139) showed 100% identity to the corresponding gene sequences of Fusarium proliferatum (GenBank Accessions; MH368119, MF033172 and KU939071) (Figure 4). Pathogenicity test was performed by inoculation with 50-μl conidial suspension (1 × 106conidia/ml) of two isolates onto three non-wounded and four wounded asymptomatic grapes berries. Sterile distilled water was used for a negative control (Figure 5). The experiment was conducted twice and berries were incubated at 25 ± 2°C in sterile moisture chambers (Ghuffar et al., 2018). White to light pink mycelium in appearance with the original symptoms were observed on both wounded and non-wounded inoculated berries after 3 days, whereas no symptoms were observed on the negative control. The morphology of the fungus that was re-isolated from each of the inoculated berries was identical to that of the original cultures. Fusarium proliferatum, one of the destructive species, causes diseases like foot-rot of corn (Farr et al., 1990), root rot of soybean (Díaz Arias et al., 2011), bakanae of rice (Zainudin et al., 2008), wilt of date palm (Khudhair et al., 2014), tomato wilt (Chehri, 2016) and tomato fruit rot (Murad et al., 2016). To our knowledge, this is the first report of Fusarium proliferatum causing fruit rot of grapes in Pakistan, where the disease poses a significant threat to the sustainability of this major fruit crop.

Download Full-text

First Report of Passalora Leaf Spot Caused by Passalora bougainvilleae on Bougainvillea in Mexico

Plant Disease ◽

10.1094/pdis-11-10-0787 ◽

2011 ◽

Vol 95 (6) ◽

pp. 775-775 ◽

Cited By ~ 1

Author(s):

V. Ayala-Escobar ◽

V. Santiago-Santiago ◽

A. Madariaga-Navarrete ◽

A. Castañeda-Vildozola ◽

C. Nava-Diaz

Keyword(s):

Uv Light ◽

Disease Incidence ◽

Morphological Characteristics ◽

The United States ◽

Pathogenicity Test ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Bougainvillea Spectabilis

Bougainvillea (Bougainvillea spectabilis Willd) growing in 28 gardens during 2009 showed 100% disease incidence and 3 to 7% disease severity. Bougainvilleas with white flowers were the most affected. Symptoms consisted of light brown spots with dark brown margins visible on adaxial and abaxial sides of the leaves. Spots were circular, 2 to 7 mm in diameter, often surrounded by a chlorotic halo, and delimited by major leaf veins. Single-spore cultures were incubated at 24°C under near UV light for 7 days to obtain conidia. Pathogenicity was confirmed by spraying a conidial suspension (1 × 104 spores/ml) on leaves of potted bougainvillea plants (white, red, yellow, and purple flowers), incubating the plants in a dew chamber for 48 h and maintaining them in a greenhouse (20 to 24°C). Identical symptoms to those observed at the residential gardens appeared on inoculated plants after 45 to 60 days. The fungus was reisolated from inoculated plants that showed typical symptoms. No symptoms developed on control plants treated with sterile distilled water. The fungus produced distinct stromata that were dark brown, spherical to irregular, and 20 to 24 μm in diameter. Conidiophores were simple, born from the stromata, loose to dense fascicles, brown, straight to curved, not branched, zero to two septate, 14 × 2 μm, with two to four conspicuous and darkened scars. The conidia formed singly, were brown, broad, ellipsoid, obclavate, straight to curved with three to four septa, 40 × 4 μm, and finely verrucous with thick hilum at the end. Fungal DNA from the single-spore cultures was obtained using a commercial DNA Extraction Kit (Qiagen, Valencia, CA); ribosomal DNA was amplified with ITS5 and ITS4 primers and sequenced. The sequence was deposited at the National Center for Biotechnology Information Database (GenBank Accession Nos. HQ231216 and HQ231217). The symptoms (4), morphological characteristics (1,2,4), and pathogenicity test confirm the identity of the fungus as Passalora bougainvilleae (Muntañola) Castañeda & Braun (= Cercosporidium bougainvilleae Muntañola). This pathogen has been reported from Argentina, Brazil, Brunei, China, Cuba, El Salvador, India, Indonesia, Jamaica, Japan, Thailand, the United States, and Venezuela (3). To our knowledge, this is the first report of this disease on B. spectabilis Willd in Mexico. P. bougainvilleae may become an important disease of bougainvillea plants in tropical and subtropical areas of Mexico. References: (1) U. Braun and R. R. Castañeda. Cryptogam. Bot. 2/3:289, 1991. (2) M. B. Ellis. More Dematiaceous Hypomycetes. Commonwealth Mycological Institute, Kew, Surrey, UK, 1976. (3) C. Nakashima et al. Fungal Divers. 26:257, 2007. (4) K. L. Nechet and B. A. Halfeld-Vieira. Acta Amazonica 38:585, 2008.

Download Full-text

First Report of Phaeoacremonium mortoniae Associated with Grapevine Decline in Iran

Plant Disease ◽

10.1094/pdis-05-11-0361 ◽

2011 ◽

Vol 95 (8) ◽

pp. 1034-1034 ◽

Cited By ~ 6

Author(s):

H. Mohammadi

Keyword(s):

Fungal Pathogens ◽

Vascular Tissue ◽

Sodium Hypochlorite Solution ◽

Malt Extract ◽

Fars Province ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Grapevine Decline

In July 2009, a survey was conducted in individually owned rooted vineyards in Iran to determine fungal pathogens associated with grapevine decline. Symptoms of grapevine decline such as slow dieback, stunted growth, small chlorotic leaves, and reduced foliage were observed on 7-year-old grapevines (cv. Askari) in Bavanat (Fars Province, southwestern Iran). Internal wood symptoms such as black spots and dark brown-to-black vascular streaking were observed in cross and longitudinal sections of stems and trunks. Wood samples were collected from symptomatic trunks and cordons. The bark of each fragment was removed and 10 thin cross sections (2 to 3 mm thick) were cut from symptomatic vascular tissue of the samples. These disks were immersed in 1.5% sodium hypochlorite solution for 4 min, washed thrice with sterile distilled water, and plated onto malt extract agar (MEA) supplemented with 100 mg liter–1 of streptomycin sulfate. Plates were incubated at 25°C in darkness. All colonies were transferred to potato dextrose agar (PDA) and incubated at 25°C. Five isolates of a Phaeoacremonium sp. were obtained. Single-spore isolates were transferred to PDA, MEA, and oatmeal agar (OA) media and incubated at 25°C for 8 to 16 days in the dark (2). Colonies reached a radius of 9.5 to 12 mm after 8 days of incubation. Colonies were flat and yellowish white on PDA and OA and white-to-pale gray after 16 days of incubation on MEA. Conidiophores were short and unbranched, 14 to 38.5 (23.5) μm long, and often ending in a single terminal phialide. Phialides were terminal or lateral and mostly monophialidic. Conidia were hyaline, oblong to ellipsoidal or reniform, 2 to 6.5 (4.9) μm long, and 1.1 to 1.7 (1.4) μm wide. On the basis of these characteristics, the isolates were identified as Phaeoacremonium mortoniae (1,2). Additionally, identity of the PMH1 isolate was confirmed by sequencing a fragment of the -tubulin gene with primers T1 and Bt2b (GenBank Accession No. JF831449). The sequence of this isolate was identical to the sequence of P. mortoniae (GenBank Accession No. HM116767). Pathogenicity tests were conducted on 2-month-old grapevine seedlings of cv. Askari by watering the roots with 25 ml of a conidial suspension (107 conidia ml–1) harvested from 21-day-old cultures grown on MEA. Controls were inoculated with 25 ml of sterile distilled water. Fifteen replicates were used for each isolate with an equal number of noninoculated plants. All plants were grown under greenhouse conditions (25 to 30°C). Two months after inoculation, inoculated seedlings showed reduced growth, chlorotic leaves, epinasty, severe defoliation, and finally wilting, while control seedlings remained healthy. The fungus was reisolated from internal tissues of the stems of inoculated seedlings. To my knowledge, this is the first report of P. mortoniae causing grapevine decline in Iran. References: (1) M. Groenewald et al. Mycol. Res. 105:651, 2001. (2) L. Mostert et al. Stud. Mycol. 54:1, 2006.

Download Full-text

First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida

Plant Disease ◽

10.1094/pdis-91-7-0905b ◽

2007 ◽

Vol 91 (7) ◽

pp. 905-905 ◽

Cited By ~ 7

Author(s):

H. K. Yun ◽

C. Louime ◽

J. Lu

Keyword(s):

United States ◽

Pcr Primers ◽

The United States ◽

Causal Agent ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Elsinoe Ampelina ◽

Muscadine Grapes

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text