First Report of Sclerotinia Stem Rot of Fennel Caused by Sclerotinia sclerotiorum in Korea

Purple coneflower (Echinacea purpurea (L.) Moench; Asteraceae), a perennial herb originating from North America, is used as a garden ornamental and is grown commercially for use in medicinal preparations as an immunostimulant. In October 1996, a previously undescribed stem rot disease was observed in a research plot of 6-month-old echinacea plants at Brooks. Seedlings had been raised in small rockwool cubes (2 × 2 × 5 cm3) in a greenhouse, then transplanted into the field in early June. By late August, dead and dying plants were observed throughout the stand. They had dark brown to black stem lesions above and at the soil level and dead leaves with bleached petiole lesions that extended ca. 15 cm above the axil. Diseased stems and petioles often disintegrated, leaving only fibrous tissues intact. Roots were rotted and black. Superficial white mycelium developed over the basal part of affected stems. Black, oblong to irregular-shaped sclerotia, 5.1 to 17.6 mm in size, formed externally on the crown areas after plant death. Sclerotinia sclerotiorum (Lib.) de Bary (1) was isolated from the diseased plants. Five isolates were selected to fulfill Koch's postulates with 3-month-old echinacea seedlings grown in 12-cm pots of soilless mix. Sclerotia from wilted, field-grown echinacea plants were transferred onto potato dextrose agar medium for 2 days at 20°C. Agar disks were cut with a 1-cm cork borer and two plugs containing sclerotial and mycelial tissues were inserted into the soilless mix 0.5 cm deep and 0.5 cm from the opposite sides of stems of test plants. Inoculated plants were enclosed in transparent plastic bags for 5 days and incubated in a growth chamber at 15/18°C (night/day) with a 12-h photoperiod. One to four lower leaves per plant wilted within 1 week after inoculation and aerial mycelia appeared on the petioles. Infected leaves quickly withered, dried, and dropped off the plant after the bags were removed. Plants often died 3 weeks after inoculation and S. sclerotiorum was reisolated from infected crown tissues. This disease was also found on 3-year-old plants of E. pallida (Nutt.) Nutt. var. angustifolia (DC.) Cronq. in Vernon, British Columbia, Canada, in May 1997. This is the first report of sclerotinia stem rot on Echinacea spp., a disease that could have a significant impact on the longevity and productivity of this crop in the field and greenhouse. Reference: (1) L. H. Purdy. Phytopathology 69:875, 1979.

Download Full-text

First Report of Stevia as a Host of Sclerotinia sclerotiorum

Plant Disease ◽

10.1094/pdis.1997.81.3.311b ◽

1997 ◽

Vol 81 (3) ◽

pp. 311-311 ◽

Cited By ~ 6

Author(s):

K. F. Chang ◽

R. J. Howard ◽

R. G. Gaudiel ◽

S. F. Hwang

Keyword(s):

Sclerotinia Sclerotiorum ◽

Higher Plants ◽

Stevia Rebaudiana ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report ◽

Stevia Rebaudiana Bertoni ◽

Dry Conditions ◽

Rot Disease ◽

Stem Lesions

Stevia (Stevia rebaudiana Bertoni; Asteraceae), an annual plant originating from Paraguay, contains glucosides of a diterpenoid (2), which is used as a low-caloric sweetener in some South American and southeast Asian countries. The main active ingredient, stevioside, is 100 to 300 times as sweet as sucrose. Stevia has been experimentally grown under field conditions in central and western Canada and has the potential to become a commercially viable alternative crop. In August 1996, a previously undescribed stem rot disease was observed on stevia plants at the Crop Diversification Centre South, Brooks, Alberta. The disease was found in research plots where 4-month-old plants were growing in loam soil. Diseased stems showed dark brown lesions above and at soil level when plant height reached approximately 30 cm. Under dry conditions, mild stem lesions caused plant stunting with lower leaves turning black and curling downward. Wilted leaf symptoms gradually spread upward in affected plants. Partial wilting symptoms appeared when girdling was restricted to branches. The entire plant collapsed when girdling of the crown and roots occurred. Superficial white mycelium developed over the basal part of affected stems under moist conditions, especially after rainy periods. Black, round to oblong sclerotia, 3.5 to 10.1 mm in size, formed externally on the crown areas after plant death. Sclerotinia sclerotiorum (Lib.) de Bary (1) was consistently isolated from the diseased plants. To confirm pathogenicity, 4-week-old stevia seedlings were obtained from shoot cuttings and grown in 12-cm pots of soilless mix. Sclerotia produced on potato dextrose agar were inserted into the mix 0.5 cm deep and 0.5 cm from the stems of test plants. Plants were placed in a growth chamber at 22°C with a 12-h photoperiod and 95% relative humidity. Two weeks after soil infestation, plants wilted and S. sclerotiorum was reisolated from the diseased crown tissues. This is the first report on stevia of sclerotinia stem rot, a disease that could significantly reduce foliar growth and stevioside production in field plantings. References: (1) L. H. Purdy. Phytopathology 69:875, 1979. (2) T. Robinson. 1991. The Organic Constituents of Higher Plants: Their Chemistry and Interrelationships. 6th ed. Cordus Press, North Amherst, MA.

Download Full-text

First Report of Sclerotinia Stem Rot of Ranunculus asiaticus Caused by Sclerotinia sclerotiorum in Korea

Plant Disease ◽

10.1094/pdis-01-15-0085-pdn ◽

2015 ◽

Vol 99 (11) ◽

pp. 1653

Author(s):

K. S. Han ◽

M. J. Park ◽

J. H. Park ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

Sclerotinia Sclerotiorum ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report ◽

Ranunculus Asiaticus

Download Full-text

First Report of Sclerotinia Stem Rot of Anemone Caused by Sclerotinia sclerotiorum in Korea

Plant Disease ◽

10.1094/pdis-12-12-1192-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 997-997 ◽

Cited By ~ 2

Author(s):

K. S. Han ◽

J. Y. Kim ◽

J. H. Park ◽

H. D. Shin

Keyword(s):

Relative Humidity ◽

Sclerotinia Sclerotiorum ◽

Crown Rot ◽

Stem Rot ◽

Economic Losses ◽

High Humidity ◽

Sclerotinia Stem Rot ◽

First Report ◽

Plant Pathol ◽

Poor Ventilation

In Korea, anemones (Anemone coronaria L.) are mostly grown during winter, in polyethylene tunnels that may have high humidity and poor ventilation, to meet the high demand of cut flowers in February and March for school ceremonies. During the winter of 2011 to 2012, symptoms typical of Sclerotinia stem rot were observed in commercial crops of anemone (cv. Rosso Mistral Plus) in Hwaseong City, Korea. About 40% of anemones withered or died before harvest due to the disease, causing considerable economic losses. In one farmer's polyethylene tunnel with a good ventilation system in Icheon City, Korea, less than 1% of the anemones showed Sclerotinia stem rot during the same season. Symptoms included stem necrosis and withering of leaves, followed by crown rot and wilt a few days afterward. White cottony growth of the fungus was observed on dead plants and the nearby soil surface, especially under high relative humidity. Black sclerotia 2 to 7 mm in diameter developed in the mycelium. Isolations from surface-disinfested stem pieces onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies. Two-week-old colonies produced plentiful numbers of sclerotia on PDA. The isolated fungus was morphologically identified as Sclerotinia sclerotiorum (Lib.) de Bary (1,3). Voucher specimens (n = 4) were deposited in the Korea University herbarium (KUS). Two isolates were deposited in the Korean Agricultural Culture Collection with accession numbers KACC46708 (ex KUS-F26433) and KACC46834 (ex KUS-F26437), respectively. Fungal DNA was extracted with a DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 (4) and sequenced using an ABI Prism 337 automatic DNA sequencer (Applied Biosystems, Foster, CA). The resulting sequences of 501 bp were deposited in GenBank (Accession Nos. KC412065 and KC412066). A BLAST search revealed that sequences of the two Korean isolates showed 100% identity with those of S. sclerotiorum (e.g., GenBank Accession No. JN012606). A pathogenicity test was achieved by placing agar segments (9 mm2) from a 7-day-old culture grown on PDA on the stems of healthy anemones (cv. Rosso Mistral Plus) near the soil line. Three plants inoculated with agar blocks served as controls. Plants were maintained in a greenhouse at 16 to 20°C and relative humidity >90%. After 2 days, all inoculated stems became discolored, soft, watery, and covered with white mycelia, whereas control plants remained symptomless. S. sclerotiorum was consistently reisolated from the symptomatic tissue, fulfilling Koch's postulates. Sclerotinia stem rot of anemones caused by S. sclerotiorum has previously been recorded from the United States and New Zealand (2), and to our knowledge, this is the first report of S. sclerotiorum on anemone in Korea. According to our observations in damaged plots, low temperature, high humidity, poor ventilation, and continuous cultivation would accelerate the incidence of Sclerotinia stem rot in polyethylene tunnel cultivation systems in Korea. References: (1) M. D. Bolton et al. Mol. Plant Pathol. 7:1, 2006. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA. Retrieved December 3, 2012. (3) S. Umemoto et al. J. Gen. Plant Pathol. 73:290, 2007. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Macleaya cordata in China

Plant Disease ◽

10.1094/pdis-08-18-1324-pdn ◽

2019 ◽

Vol 103 (3) ◽

pp. 584

Author(s):

L. Zhou ◽

L. Yu ◽

P. Huang ◽

W. Liu ◽

Z. Tang ◽

...

Keyword(s):

Sclerotinia Sclerotiorum ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report ◽

Macleaya Cordata

Download Full-text

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Chinese chives in Korea

Plant Disease ◽

10.1094/pdis-04-17-0587-pdn ◽

2017 ◽

Vol 101 (11) ◽

pp. 1953-1953 ◽

Cited By ~ 1

Author(s):

I. Y. Choi ◽

J. Kim ◽

W. H. Lee ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

Sclerotinia Sclerotiorum ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report ◽

Chinese Chives

Download Full-text

First Report of Sclerotinia Stem Rot of Chickpea Caused by Sclerotinia sclerotiorum in North Dakota and Washington

Plant Disease ◽

10.1094/pd-90-0114a ◽

2006 ◽

Vol 90 (1) ◽

pp. 114-114 ◽

Cited By ~ 5

Author(s):

W. Chen ◽

B. Schatz ◽

B. Henson ◽

K. E. McPhee ◽

F. J. Muehlbauer

Keyword(s):

North Dakota ◽

Sclerotinia Sclerotiorum ◽

Disease Incidence ◽

Ascochyta Blight ◽

Growing Season ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Stem Breakage

Chickpea (Cicer arietinum L.) is cultivated as a rotational crop in the cereal-based production system in the U.S. Pacific Northwest (PNW) and its production is expanding to other northern tier states. During July 2005, symptoms of Sclerotinia stem rot were observed on chickpea cv. Dwelley and Dylan in fields near Spangle, WA and Carrington, ND, respectively, with disease incidence of approximately ≤1% in affected areas at both locations. Symptoms included stem whitening, wilting, and stem breakage. Occasionally, white fluffy mycelium was observed; however, production of sclerotia on infected plants was rarely observed. Sclerotinia sclerotiorum was isolated from diseased stems collected from both states. The isolates produced a ring of sclerotia near the edge of potato dextrose agar (PDA) plates in 7 days and produced neither conidia nor other fruiting bodies in culture after 30 days. PCR amplification of the rDNA internal transcribed spacer region from two representative isolates and subsequent digestion with restriction enzymes, Mbo I and Taq I, produced identical banding patterns to previously identified isolates of S. sclerotiorum from pea from the PNW (2). Chickpea cvs. Dwelley and Spanish White (eight plants of each) were inoculated by fastening mycelial agar plugs from an actively growing colony on PDA onto the stems with Parafilm. Symptoms of stem whitening were observed as early as 2 days after inoculation, and the lesions extended upward and downward from the inoculation site. Wilting and stem breakage were also observed. Control inoculations of four plants of each cultivar with PDA plugs without mycelium produced no visible symptoms. S. sclerotiorum was consistently reisolated from inoculated plants but not from control plants. Chickpea had been grown in the PNW for more than 20 years without any reported incidence of Sclerotinia stem rot although the disease has been reported from Arizona (3) and Asian countries (1). This is likely because of the upright growth habit of the chickpea plant coupled with relatively dry conditions late in the growing season. Previous chickpea cultivars were very susceptible to Ascochyta blight, an early-season disease of chickpea in the PNW that reduced chickpea stands and canopy coverage. Current cultivars possess much improved resistance to Ascochyta blight, allowing greater vegetative growth to occur and creating microenvironmental conditions conducive to Sclerotinia stem rot. In North Dakota, where humid conditions prevail late in the growing season, symptoms of Sclerotinia stem rot had been observed in previous years but had not been documented because of a recent history of chickpea cultivation there. To our knowledge, this is the first report of confirmed Sclerotinia stem rot of chickpea in North Dakota and Washington. References: (1) G. J. Boland and R. Hall. Can. J. Plant Pathol. 16:93, 1994. (2) I. Jimenez-Hidalgo et al. Phytopathology (Abstr.) 94(suppl.):S47, 2004. (3) M. E. Matheron and M. Porchas. Plant Dis. 84:1250, 2000.

Download Full-text

First Report of Oilseed Rape Stem Rot Caused by Sclerotinia sclerotiorum in Greece

Plant Disease ◽

10.1094/pdis-92-10-1473c ◽

2008 ◽

Vol 92 (10) ◽

pp. 1473-1473 ◽

Cited By ~ 1

Author(s):

G. T. Tziros ◽

G. A. Bardas ◽

J. T. Tsialtas ◽

G. S. Karaoglanidis

Keyword(s):

Oilseed Rape ◽

Sclerotinia Sclerotiorum ◽

Morphological Characteristics ◽

The United States ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

Brassica Napus L ◽

First Report ◽

Plastic Bag ◽

Pathogenicity Tests

Oilseed rape (Brassica napus L.) was recently introduced into Greece for the production of biofuels. During May of 2007, symptoms typical of stem rot were observed on oilseed rape plants in three commercial fields in the area of Galatades-Pella, Central Macedonia, Greece. Approximately 30% of the plants were affected. Symptoms began as a chlorotic wilt on the foliage and developed into necrosis of basal stems. In the advanced stages of the disease, stems and branches became bleached and eventually died. White, as well as black, mycelium and irregularly shaped sclerotia (2 to 5 mm in diameter) were produced abundantly on and inside the affected stems. To isolate the pathogen, 20 symptomatic 6-month-old plants were collected from each field. Sclerotia were dipped in 70% ethanol, surface sterilized in 1% sodium hypochlorite for 1 min, and rinsed in sterile water. Sclerotia placed on potato dextrose agar (PDA) were incubated in the dark at 25°C for 10 days. Sclerotinia sclerotiorum (Lib.) de Bary was identified on the basis of morphological characteristics (2). To conduct pathogenicity tests, 10 6-week-old oilseed rape plants (cv. Titan) were each inoculated with a 5-mm-diameter colonized PDA disk placed in wounds made in the basal stem with a sterile scalpel. Five control plants were treated similarly except that the agar disk did not contain mycelium. Plants were then covered with a plastic bag to maintain high humidity. After 72 h, the bags were removed and the plants were maintained in a growth chamber at 23 to 25°C with a 12-h photoperiod and 75% relative humidity. Pathogenicity tests were repeated three times. Symptoms identical to those observed in the field developed within 12 days after inoculation; control plants remained healthy. The fungus was reisolated from all inoculated plants, confirming Koch's postulates. S. sclerotiorum has been reported on oilseed rape in Argentina, Australia, Brazil, Canada, the United States, and New Zealand (1). To our knowledge, this is the first report of Sclerotinia stem rot of oilseed rape in Greece. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2008. (2) L. M. Kohn. Phytopathology 69:881, 1979.

Download Full-text

First Report of Sclerotinia Stem Rot of Marsh Mallow Caused by Sclerotinia sclerotiorum in Korea

Plant Disease ◽

10.1094/pdis-07-15-0769-pdn ◽

2016 ◽

Vol 100 (4) ◽

pp. 858-858

Author(s):

K. M. Kim ◽

G. Y. Won ◽

I. Y. Choi

Keyword(s):

Sclerotinia Sclerotiorum ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report

Download Full-text

First Report of Sclerotinia Stem Rot of Canola Caused by Sclerotinia sclerotiorum in Texas

Plant Disease ◽

10.1094/pdis-94-6-0792b ◽

2010 ◽

Vol 94 (6) ◽

pp. 792-792 ◽

Cited By ~ 1

Author(s):

T. Isakeit ◽

J. E. Woodward ◽

C. Niu ◽

R. J. Wright

Keyword(s):

Sclerotinia Sclerotiorum ◽

Pcr Amplification ◽

Soil Surface ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

Brassica Napus L ◽

First Report ◽

Winter Crop ◽

Symptomatic Tissue ◽

Fungal Dna

During the past several years, canola (Brassica napus L.) has been grown experimentally in different areas of Texas to evaluate its potential as a crop, particularly for use as a biofuel source. In early April 2007, symptoms typical of Sclerotinia stem rot were observed in a canola variety trial that was flowering in Wharton County, Texas. Stems had white mycelia growing on the outside, or a bleached appearance, near the soil surface and plants were lodging. Inside bleached stems, there were spherical to cylindrical, black sclerotia that were 3 to 10 mm. Isolations from surface-disinfested stems onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies with sclerotia typical of Sclerotinia sclerotiorum (Lib.) de Bary (1). Sequence analyses were conducted on two replicates of mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using two primer sequences (92-4 AF377919: TCGCCTCAGAAGAATGTGC/AGCGGGTTACAAGGAGATGG; and 119-4 AF377925: GTAACAAGAGACCAAAATTCGG/TGAACGAGCTGTCATTCCC) (2) that have previously been used to characterize S. sclerotiorum (3). The BLAST search revealed that the sequences were 99 and 98% homologous with S. sclerotiorum Accession Nos. AF377919 and AF377925 over 376 and 377 bp of aligned sequence, respectively. Agar segments (1 cm2) from a 5-day-old culture grown on PDA were placed in the leaf axils of 15 2-month-old canola plants (‘Wichita’) growing in pots. Plants were placed in a humid chamber under fluorescent lights at 16 to 22°C. After 2 days, water soaking and necrosis occurred on petioles and stems adjacent to the inoculum, but not on plants treated with sterile PDA. S. sclerotiorum was consistently reisolated from symptomatic tissue plated on acidified PDA. The inoculations were repeated once with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of canola in Texas. Currently, there is no significant canola production in Texas; however, interest in biofuels could lead to an increase in planted acres. Sclerotinia stem rot of canola could become a significant disease problem in areas of Texas where canola is planted as a winter crop. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (3) J. E. Woodward et al. Plant Dis. 92:1468, 2008.

Download Full-text