First Report of Oilseed Rape Stem Rot Caused by Sclerotinia sclerotiorum in Greece

Oilseed rape (Brassica napus L.) was recently introduced into Greece for the production of biofuels. During May of 2007, symptoms typical of stem rot were observed on oilseed rape plants in three commercial fields in the area of Galatades-Pella, Central Macedonia, Greece. Approximately 30% of the plants were affected. Symptoms began as a chlorotic wilt on the foliage and developed into necrosis of basal stems. In the advanced stages of the disease, stems and branches became bleached and eventually died. White, as well as black, mycelium and irregularly shaped sclerotia (2 to 5 mm in diameter) were produced abundantly on and inside the affected stems. To isolate the pathogen, 20 symptomatic 6-month-old plants were collected from each field. Sclerotia were dipped in 70% ethanol, surface sterilized in 1% sodium hypochlorite for 1 min, and rinsed in sterile water. Sclerotia placed on potato dextrose agar (PDA) were incubated in the dark at 25°C for 10 days. Sclerotinia sclerotiorum (Lib.) de Bary was identified on the basis of morphological characteristics (2). To conduct pathogenicity tests, 10 6-week-old oilseed rape plants (cv. Titan) were each inoculated with a 5-mm-diameter colonized PDA disk placed in wounds made in the basal stem with a sterile scalpel. Five control plants were treated similarly except that the agar disk did not contain mycelium. Plants were then covered with a plastic bag to maintain high humidity. After 72 h, the bags were removed and the plants were maintained in a growth chamber at 23 to 25°C with a 12-h photoperiod and 75% relative humidity. Pathogenicity tests were repeated three times. Symptoms identical to those observed in the field developed within 12 days after inoculation; control plants remained healthy. The fungus was reisolated from all inoculated plants, confirming Koch's postulates. S. sclerotiorum has been reported on oilseed rape in Argentina, Australia, Brazil, Canada, the United States, and New Zealand (1). To our knowledge, this is the first report of Sclerotinia stem rot of oilseed rape in Greece. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. ARS, USDA, 2008. (2) L. M. Kohn. Phytopathology 69:881, 1979.

Download Full-text

First Report of Sclerotinia Stem Rot and Death of Osteospermum spp. Hybrid Cultivars Caused by Sclerotinia sclerotiorum in Louisiana

Plant Disease ◽

10.1094/pd-89-0911a ◽

2005 ◽

Vol 89 (8) ◽

pp. 911-911 ◽

Cited By ~ 1

Author(s):

G. E. Holcomb

Keyword(s):

Sclerotinia Sclerotiorum ◽

Disease Incidence ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

Greenhouse Production ◽

First Report ◽

Similar Disease ◽

Plastic Bag ◽

Pathogenicity Tests ◽

Stem Lesions

Osteospermum spp. Hybrids, belong to Asteraceae, commonly called African daisy or cape daisy with over 214 named cultivars, are popular flowering plants grown as winter landscape plants in southern Louisiana. During January of 2005, plants growing in a wholesale nursery using polyethylene-film-covered greenhouses were observed with symptoms of wilt that began with tan stem lesions and progressed to stem rot, wilt, and plant death. Plants had been purchased out-of-state as rooted cuttings and transplanted to a commercial bark potting mix in 11.4-cm (4.5-in.) plastic pots. Signs of fungal infection included the presence of white cottony mycelium and black sclerotia. Disease incidence was 50% on cv. Soprano White but less than 1% among the four other cultivars being grown (Ostica Blue Eye, Ostica Pink, Lemon Symphony, and Soprano Purple). Differences in disease incidence among cultivars may have been due to differences in susceptibility since all were grown on the same greenhouse bench. Sclerotinia sclerotiorum was consistently isolated from sections of diseased stems that had been surfaced disinfested (30 to 60 s in 70% ethyl alcohol) and placed on acidified potato dextrose agar. Inoculum for pathogenicity tests consisted of mixed mycelia and sclerotia that had been grown on twice-sterilized wheat grain for 14 days. Ten flowering-age Osteospermum sp. plants of cv. Soprano White were inoculated with 1 g of inoculum placed at the base of each plant. One group of five plants was kept in a dew chamber at 22°C for 40 h after which they were removed to a greenhouse. The second group of five plants was placed in a single, plastic bag with the top left open and kept in the greenhouse. Ten noninoculated plants of the same cultivar served as controls with five kept in the dew chamber for 40 h and the other five held in a plastic bag in the greenhouse. Inoculated plants that had been held in the dew chamber developed stem lesions and rot after 2 days, wilted permanently after 5 days, and were desiccated and dead by day 7. Inoculated plants held in the bag in the greenhouse followed a similar disease development pattern but did not show wilt symptoms until 8 days after inoculation and were dead after 12 days. White cottony mycelium and black sclerotia developed on stems and at the base of all inoculated plants. S. sclerotiorum was reisolated from inoculated diseased plants. All noninoculated control plants remained disease free. An outbreak of this disease was previously reported on Osteospermum spp. planted along highways in southern California (1). To our knowledge, this is the first report of the disease in Louisiana and the first report of its occurrence in greenhouse production of Osteospermum spp. Reference: (1) H. S. Gill. Plant Dis. Rep. 59:82, 1975

Download Full-text

First Report of Sclerotinia Stem Rot of Canola Caused by Sclerotinia sclerotiorum in Texas

Plant Disease ◽

10.1094/pdis-94-6-0792b ◽

2010 ◽

Vol 94 (6) ◽

pp. 792-792 ◽

Cited By ~ 1

Author(s):

T. Isakeit ◽

J. E. Woodward ◽

C. Niu ◽

R. J. Wright

Keyword(s):

Sclerotinia Sclerotiorum ◽

Pcr Amplification ◽

Soil Surface ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

Brassica Napus L ◽

First Report ◽

Winter Crop ◽

Symptomatic Tissue ◽

Fungal Dna

During the past several years, canola (Brassica napus L.) has been grown experimentally in different areas of Texas to evaluate its potential as a crop, particularly for use as a biofuel source. In early April 2007, symptoms typical of Sclerotinia stem rot were observed in a canola variety trial that was flowering in Wharton County, Texas. Stems had white mycelia growing on the outside, or a bleached appearance, near the soil surface and plants were lodging. Inside bleached stems, there were spherical to cylindrical, black sclerotia that were 3 to 10 mm. Isolations from surface-disinfested stems onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies with sclerotia typical of Sclerotinia sclerotiorum (Lib.) de Bary (1). Sequence analyses were conducted on two replicates of mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using two primer sequences (92-4 AF377919: TCGCCTCAGAAGAATGTGC/AGCGGGTTACAAGGAGATGG; and 119-4 AF377925: GTAACAAGAGACCAAAATTCGG/TGAACGAGCTGTCATTCCC) (2) that have previously been used to characterize S. sclerotiorum (3). The BLAST search revealed that the sequences were 99 and 98% homologous with S. sclerotiorum Accession Nos. AF377919 and AF377925 over 376 and 377 bp of aligned sequence, respectively. Agar segments (1 cm2) from a 5-day-old culture grown on PDA were placed in the leaf axils of 15 2-month-old canola plants (‘Wichita’) growing in pots. Plants were placed in a humid chamber under fluorescent lights at 16 to 22°C. After 2 days, water soaking and necrosis occurred on petioles and stems adjacent to the inoculum, but not on plants treated with sterile PDA. S. sclerotiorum was consistently reisolated from symptomatic tissue plated on acidified PDA. The inoculations were repeated once with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of canola in Texas. Currently, there is no significant canola production in Texas; however, interest in biofuels could lead to an increase in planted acres. Sclerotinia stem rot of canola could become a significant disease problem in areas of Texas where canola is planted as a winter crop. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (3) J. E. Woodward et al. Plant Dis. 92:1468, 2008.

Download Full-text

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Hibiscus trionum in New York

Plant Disease ◽

10.1094/pdis-93-6-0673a ◽

2009 ◽

Vol 93 (6) ◽

pp. 673-673

Author(s):

J. Strauss ◽

H. R. Dillard

Keyword(s):

United States ◽

Sclerotinia Sclerotiorum ◽

The United States ◽

Potato Dextrose Agar ◽

Stem Rot ◽

Stem Tissue ◽

Sclerotinia Stem Rot ◽

American Phytopathological Society ◽

First Report ◽

Hibiscus Trionum

Hibiscus trionum L. (Venice mallow) is an annual weed widely distributed in the United States. In September of 2008, Venice mallow plants with bleached stems and necrotic tissues were observed in a commercial field of cabbage (Brassica oleracea L. cv. Moreton) in Geneva, NY. White, cottony mycelium and dark sclerotia were readily found on the stems and in the stem pith. Cabbage plants in direct contact with diseased Venice mallow also displayed signs and symptoms of infection by Sclerotinia sclerotiorum (Lib.) de Bary. Sclerotia from within diseased Venice mallow stems were placed in 9-cm-diameter petri plates on potato dextrose agar amended with 0.1 g/liter each of chloramphenicol and streptomycin (ABPDA) and incubated at room temperature. In addition, diseased stem tissue was surface disinfested for 3 min in 0.525% sodium hypochlorite solution, rinsed for 3 min in sterile distilled water, and placed on ABPDA. After 5 days, hyphae from the colony margin were excised and transferred to potato dextrose agar (PDA) plates. Fungal cultures consisting of white mycelia and medium-sized (~4 mm), black, irregular sclerotia were consistently recovered and identified as S. sclerotiorum based on morphological characteristics (1). Pathogenicity of two isolates (one from a sclerotium and one from stem tissue) was determined by inoculating seven 43-day-old Venice mallow plants growing in greenhouse pots (65 mm in diameter). Mycelia plugs (7 mm in diameter) were excised from 2-day-old PDA cultures of each isolate and placed on the stems at the soil line. Seven control plants were inoculated with noncolonized PDA plugs. All plants were enclosed in plastic bags for 72 h and placed under shade in the greenhouse with temperatures from 20 to 38°C (average 27°C). Symptoms similar to those observed in the affected fields were evident within 2 days after inoculation, while control plants remained symptomless. S. sclerotiorum was successfully recovered from infected plant tissue, fulfilling Koch's postulates. The experiment was repeated with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of Hibiscus trionum caused by S. sclerotiorum (2,3). References: (1) L. Buchwaldt. Sclerotinia White Mold. Page 43 in: Compendium of Brassica Diseases, 1st ed. S. R. Rimmer et al., eds. The American Phytopathological Society, St. Paul, MN, 2007. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, MN, 1989. (3) C. Wehlburg et al. Index of Plant Diseases in Florida. Fla Dep. Agric. Consum. Serv. Bull. 11, 1975.

Download Full-text

First Report of White Mold Caused by Sclerotinia sclerotiorum on Sweet Basil in Turkey

Plant Disease ◽

10.1094/pdis-92-10-1471c ◽

2008 ◽

Vol 92 (10) ◽

pp. 1471-1471 ◽

Cited By ~ 1

Author(s):

F. M. Tok

Keyword(s):

Sclerotinia Sclerotiorum ◽

Morphological Characteristics ◽

The United States ◽

Ocimum Basilicum ◽

Pathogenicity Test ◽

Distilled Water ◽

First Report ◽

Sweet Basil ◽

Pathogenicity Tests ◽

Filter Papers

In February of 2008, wilt and collapse of sweet basil (Ocimum basilicum L.) was observed on approximately 20% of the plants in a commercial greenhouse in Demre, Antalya, Turkey. Crown and stems of infected plants were necrotic; leaves turned brown and wilted. Profuse, white mycelia and occasionally black sclerotia were found inside and outside of affected stems. Sclerotinia sclerotiorum (Lib). de Bary, identified based on morphological characteristics was isolated from sclerotia and symptomatic stems on potato dextrose agar amended with tetracycline. To conduct pathogenicity tests, sclerotia produced on carrot discs were surface disinfested in 70% ethanol and dried on sterilized filter papers. Ten sclerotia were placed in 9-cm-diameter glass petri plates containing 15 ml of sterilized distilled water. Plates were wrapped with Parafilm and incubated at 4°C for 5 to 6 weeks in the dark. Plates were then incubated at 15°C in 12 h of dark and 12 h of light. Apothecia developed after 2 weeks. Ascospores were harvested from apothecia with distilled water by crushing and shaking the apothecia in centrifuge tubes. Thirty basil plants sprayed with ascospores (106 spores per ml) were maintained in a growth chamber at 22°C and 90% humidity. After 2 weeks, necrotic leaves and stems were observed on all inoculated plants. S. sclerotiorum was recovered from symptomatic tissues. No symptoms developed on the 30 basil plants sprayed with sterile distilled water. The pathogenicity test was repeated with similar results. S. sclerotiorum on basil has been reported in Canada (4), the United States, (2,3), and Italy (1). To our knowledge, this is the first report of S. sclerotiorum on basil in Turkey. References: (1) A. Garibaldi et al. Plant Dis. 81:124, 1997. (2) G. E. Holcomb and M. J. Reed. Plant Dis. 78:924, 1994. (3) S. T. Koike. Plant Dis. 84:1342, 2000. (4) T. C. Paulitz. Plant Dis. 81:229, 1997.

Download Full-text

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Brassica carinata in Florida

Plant Disease ◽

10.1094/pdis-06-12-0525-pdn ◽

2012 ◽

Vol 96 (10) ◽

pp. 1581-1581 ◽

Cited By ~ 2

Author(s):

H. M. Young ◽

P. Srivastava ◽

M. L. Paret ◽

H. Dankers ◽

D. L. Wright ◽

...

Keyword(s):

Sclerotinia Sclerotiorum ◽

Room Temperature ◽

Cropping Systems ◽

Morphological Characteristics ◽

Pcr Amplification ◽

Brassica Carinata ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report ◽

Del Rio

Brassica carinata A. Braun, commonly referred to as Ethiopian rapeseed, a near relative of collards and mustard, has become the object of increasing interest as an oil crop. It has been reported that B. carinata adapts better and is more productive than B. napus (canola) in adverse conditions, such as clay and sandy soils and under low management cropping systems (1). In late February 2012, symptoms typical of sclerotinia stem rot were observed in B. carinata trials (cultivars 090867 EM and 080814 EM) at the University of Florida, North Florida Research and Education Center located in Quincy, FL. Approximately 20 to 30% of the B. carinata cultivar 090867 EM were observed to have symptoms and approximately 5% of cultivar 080814 EM displayed symptoms. Stems had white mycelia growing on the outside, plants were lodging and spherical to cylindrical, 3 to 8 mm, and black sclerotia were found outside and inside bleached stems. Sclerotia from diseased stems were surface sterilized and placed in 9-cm diameter petri plates on quarter strength potato dextrose agar (PDA) amended with 25% lactic acid. Fungal cultures consisting of white mycelia and medium-sized (mean 4 mm), black, irregular sclerotia were consistently recovered and identified as Sclerotinia sclerotiorum (Lib.) de Bary based on morphological characteristics (3). Sequence analyses were conducted on mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using primers ITS1 and ITS4. The BLAST search revealed that the sequence (GenBank Accession No. JX307092) had 99 and 100% sequence identity with S. sclerotiorum GenBank accessions JN013184.1 and JN012606.1. Pathogenicity was determined by inoculating six 1-month-old B. carinata plants (cultivars 090867 EM and 080814 EM) that were grown in greenhouse pots (20 cm in diameter). Mycelia plugs (8 mm in diameter) were excised from the colony margin after 6 days of incubation at room temperature (approximately 25°C), and placed on stems, at the soil line, of B. carinata plants. Six control plants were inoculated with noncolonized PDA plugs. All plants were enclosed in plastic bags that had been sprayed with water on the inside to maintain high humidity and kept in the laboratory at room temperature (approximately 25°C). Symptoms similar to those observed in the field were evident after 3 days on inoculated plants and S. sclerotiorum was reisolated. In the controls, no symptoms developed and the fungus could not be isolated. The experiment was repeated with similar results. The majority of rapeseed production is in North Dakota, where sclerotinia stem rot caused by S. sclerotiorum is a major fungal disease affecting production (2). Currently, there is no significant B. carinata production in Florida; however, interest in biofuels could lead to an increase in planted acreage and sclerotinia stem rot could become a significant disease problem in areas of Florida were B. carinata is planted. To our knowledge, this is the first report of sclerotinia stem rot of B. carinata caused by S. sclerotiorum in Florida. References: (1) M. Cardone et al. Biomass and Bioenergy. 25:623, 2003. (2) L. E. del Río et al. Plant Dis. 91:191, 2007. (3) L. M. Kohn. Phytopathology 69:881, 1979.

Download Full-text

Effects of a foliar fertilizer containing boron on the development of Sclerotinia stem rot ( Sclerotinia sclerotiorum ) on canola ( Brassica napus L.) leaves

Journal of Phytopathology ◽

10.1111/jph.12865 ◽

2019 ◽

Vol 168 (1) ◽

pp. 47-55 ◽

Cited By ~ 2

Author(s):

Li Ni ◽

Zamir K. Punja

Keyword(s):

Brassica Napus ◽

Sclerotinia Sclerotiorum ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

Brassica Napus L ◽

Foliar Fertilizer

Download Full-text

First report of stem rot of rosemary caused by Sclerotinia sclerotiorum in the United States

Plant Pathology ◽

10.1111/j.0032-0862.2004.00964.x ◽

2004 ◽

Vol 53 (2) ◽

pp. 252-252 ◽

Cited By ~ 4

Author(s):

M. L. Putnam

Keyword(s):

United States ◽

Sclerotinia Sclerotiorum ◽

The United States ◽

Stem Rot ◽

First Report

Download Full-text

First Report of Sclerotinia Stem Rot of Fennel Caused by Sclerotinia sclerotiorum in Korea

Plant Disease ◽

10.1094/pdis-05-15-0512-pdn ◽

2016 ◽

Vol 100 (1) ◽

pp. 223-223 ◽

Cited By ~ 1

Author(s):

I. Y. Choi ◽

J. H. Kim ◽

B. S. Kim ◽

M. J. Park ◽

H. D. Shin

Keyword(s):

Sclerotinia Sclerotiorum ◽

Stem Rot ◽

Sclerotinia Stem Rot ◽

First Report

Download Full-text

First Report of Sclerotinia sclerotiorum on Coneflower

Plant Disease ◽

10.1094/pdis.1997.81.9.1093a ◽

1997 ◽

Vol 81 (9) ◽

pp. 1093-1093 ◽

Cited By ~ 2

Author(s):

K. F. Chang ◽

R. J. Howard ◽

R. G. Gaudiel ◽

S. F. Hwang

Keyword(s):

Sclerotinia Sclerotiorum ◽

Echinacea Purpurea ◽

Stem Rot ◽

Perennial Herb ◽

Sclerotinia Stem Rot ◽

Transparent Plastic ◽

Potato Dextrose Agar Medium ◽

First Report ◽

Plastic Bags ◽

Stem Lesions

Purple coneflower (Echinacea purpurea (L.) Moench; Asteraceae), a perennial herb originating from North America, is used as a garden ornamental and is grown commercially for use in medicinal preparations as an immunostimulant. In October 1996, a previously undescribed stem rot disease was observed in a research plot of 6-month-old echinacea plants at Brooks. Seedlings had been raised in small rockwool cubes (2 × 2 × 5 cm3) in a greenhouse, then transplanted into the field in early June. By late August, dead and dying plants were observed throughout the stand. They had dark brown to black stem lesions above and at the soil level and dead leaves with bleached petiole lesions that extended ca. 15 cm above the axil. Diseased stems and petioles often disintegrated, leaving only fibrous tissues intact. Roots were rotted and black. Superficial white mycelium developed over the basal part of affected stems. Black, oblong to irregular-shaped sclerotia, 5.1 to 17.6 mm in size, formed externally on the crown areas after plant death. Sclerotinia sclerotiorum (Lib.) de Bary (1) was isolated from the diseased plants. Five isolates were selected to fulfill Koch's postulates with 3-month-old echinacea seedlings grown in 12-cm pots of soilless mix. Sclerotia from wilted, field-grown echinacea plants were transferred onto potato dextrose agar medium for 2 days at 20°C. Agar disks were cut with a 1-cm cork borer and two plugs containing sclerotial and mycelial tissues were inserted into the soilless mix 0.5 cm deep and 0.5 cm from the opposite sides of stems of test plants. Inoculated plants were enclosed in transparent plastic bags for 5 days and incubated in a growth chamber at 15/18°C (night/day) with a 12-h photoperiod. One to four lower leaves per plant wilted within 1 week after inoculation and aerial mycelia appeared on the petioles. Infected leaves quickly withered, dried, and dropped off the plant after the bags were removed. Plants often died 3 weeks after inoculation and S. sclerotiorum was reisolated from infected crown tissues. This disease was also found on 3-year-old plants of E. pallida (Nutt.) Nutt. var. angustifolia (DC.) Cronq. in Vernon, British Columbia, Canada, in May 1997. This is the first report of sclerotinia stem rot on Echinacea spp., a disease that could have a significant impact on the longevity and productivity of this crop in the field and greenhouse. Reference: (1) L. H. Purdy. Phytopathology 69:875, 1979.

Download Full-text