scholarly journals First Report of Grapevine fleck virus in Idaho Grapevines

Plant Disease ◽  
2012 ◽  
Vol 96 (11) ◽  
pp. 1705-1705 ◽  
Author(s):  
E. Kanuya ◽  
L. A. Clayton ◽  
R. A. Naidu ◽  
A. V. Karasev
Keyword(s):  
The State ◽  
River Valley ◽  
Pinot Noir ◽  
Nez Perce ◽  
Wine Grape ◽  
Rt Pcr ◽  
Wine Grapes ◽  
First Report ◽  
Planting Material ◽  
Grape Cultivars

Idaho has a growing viticulture industry, with nearly 1,600 acres of wine grapes (Vitis vinifera L.). Production is largely concentrated in two locations, the Snake River valley, which includes Canyon County in the southwest, and the Clearwater River valley, primarily Nez Perce County in the northwest. Grapevine fleck virus (GFkV) belongs to the genus Maculavirus, family Tymoviridae, comprising positive-sense, single-stranded RNA viruses with ca. 7.6-kb genome (3). It is one of five non-mechanically transmitted viruses associated with the fleck disease complex and has been previously documented to occur in the neighboring state of Washington (2). Main sources of wine grape nursery material imported to Idaho reside in Washington or in California, and it is important to monitor virus status of the planting material brought to the state. However, no information was available on the occurrence and prevalence of GFkV in wine grapes in Idaho. During three growing seasons in 2009 through 2011, random grapevine samples were collected in 14 vineyards in Canyon, Elmore, Ada, and Nez Perce counties. A total of 434 samples were tested by one step RT-PCR using GFkV-specific primers, GFkVf: 5′-TGACCAGCCTGCTGTCTCTA-3′ and GFkVr: 5′-TGGACAGGGAGGTGTAGGAG-3′ designed to amplify a fragment of the GFkV capsid protein gene (1). Twenty-four samples tested positive for GFkV by RT-PCR and produced the expected 179-bp DNA fragment. These samples came from five vineyards sampled across all surveyed counties, and represented seven wine grape cultivars, including Pinot Noir, Cabernet Sauvignon, Syrah, Lemberger, Riesling, Chardonnay, Pinot Gris, and one unknown table grape cultivar. Twelve PCR products were cloned into the pGEM-T Easy plasmid vector (Promega), sequenced (numbered ID1 to 12, available upon request), and confirmed to represent fragments of the GFkV CP gene between positions 6,453 and 6,631 in the genome of GFkV isolate MT48 (GenBank Accession No. AJ309022.1). Eight of the Idaho GFkV sequences (ID2, ID3, ID7 to 11, and ID12) matched closely with other GFkV sequences from Washington State, Italy, India, and South America, showing 97 to 99% identity at the nucleotide level in pair-wise comparisons. Four GFkV sequences from Idaho (ID1 and ID4 to 6) showed only modest (90 to 92%) identity in pair-wise comparisons with GFkV sequences available in GenBank. Consequently, in phylogenetic reconstructions eight Idaho GFkV sequences clustered in the same lineage with the six GFkV sequences deposited in GenBank, and four other GFkV sequences were placed outside of this main clade. It is possible that this phylogeny of the Idaho GFkV reflects different sources of the virus-infected planting material brought to the state. In the absence of symptoms expressed in wine grape cultivars infected with GFkV, laboratory methods remain the only tool to detect the virus. To our knowledge, this is the first report of GFkV found in wine grapes in Idaho demonstrating its substantial presence in production areas. References: (1) G. Gambino and I. Gribaudo. Phytopathology 96:1223, 2006. (2) R. A. Naidu et al. Plant Dis. 94:784, 2010. (3) S. Sabanadzovic et al. J. Gen. Virol. 82:2009, 2001.

scholarly journals First report of grapevine rupestris vein feathering virus in wine grapes in Idaho

Plant Disease ◽  
2021 ◽  
Author(s):  
Jennifer Dahan ◽  
Brandon Thompson ◽  
Jungmin Lee ◽  
Alexander V Karasev
Keyword(s):  
High Throughput Sequencing ◽  
The United States ◽  
Washington State ◽  
Vitis Vinifera L ◽  
Wine Grape ◽  
Rt Pcr ◽  
Wine Grapes ◽  
Pairwise Identity ◽  
First Report ◽  
Hop Stunt Viroid

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3’-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5’- GAAGCAACAGTGCCCGTCTC -3’) and GRVFV-R1 (5’- AGGTCGCTTTACGGACCTTTTCTT -3’). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

scholarly journals First Report of Grapevine leafroll-associated virus-3 in Six Wine Grape Cultivars in Idaho

Plant Disease ◽  
2009 ◽  
Vol 93 (11) ◽  
pp. 1218-1218 ◽  
Author(s):  
T. A. Mekuria ◽  
A. V. Karasev ◽  
R. R. Martin ◽  
R. A. Naidu
Keyword(s):  
Virus Disease ◽  
Amino Acid Level ◽  
Pairwise Comparison ◽  
Cabernet Sauvignon ◽  
Wine Grape ◽  
Rt Pcr ◽  
Hsp 70 ◽  
Wine Grapes ◽  
Wine Production ◽  
First Report

In recent years, wine grape (Vitis vinifera) acreage in Idaho has expanded because of favorable climatic conditions for premium wine production. Nearly 95% of the 491.7 ha (1,215 acres) of wine grapes are in the Snake River Valley with Canyon County accounting for 81% of the vines. Previous studies have shown that grapevine leafroll disease (GLD) is the most widespread and economically significant virus disease in wine grapes in Washington and Oregon (1,2). However, little is known about the incidence and economic impact of GLD on wine grapes in Idaho. During the 2008 growing season, leaf samples were collected from approximately 25 individual grapevines of red-berried cultivars (Cabernet Sauvignon, Merlot, Syrah, and Petit Syrah) showing GLD symptoms and white-berried (Chardonnay) cultivars with suspected GLD symptoms growing in 10 geographically separate vineyards in Canyon County. An additional five samples were collected from a Lemberger block in Elmore County. Petiole extracts from these samples were tested by single-tube reverse transcription (RT)-PCR with primers LC 1 (5′-CGC TAG GGC TGT GGA AGT ATT-3′) and LC 2 (5′-GTT GTC CCG GGT ACC AGA TAT-3′) specific for the heat shock protein 70 homologue (HSP-70 gene) of Grapevine leafroll-associated virus-3 (GLRaV-3) (3). All samples, except the Petit Syrah, produced a single band of the expected size of 546 bp. ELISA with GLRaV-3-specific antibodies (BIOREBA AG, Reinach, Switzerland) confirmed the presence of the virus in samples that were positive in RT-PCR. GLRaV-3-specific amplicons were cloned in pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA) and 2 to 3 independent clones per isolate were sequenced in both orientations. A pairwise comparison of 22 sequences, six from Chardonnay (GenBank Accessions GQ344810, GQ344811, GQ344823, GQ344824, GQ344825, and GQ344826), five from Cabernet Sauvignon (GQ344807, GQ344808, GQ344809, GQ344827, and GQ344828), four each from Merlot (GQ344815, GQ344816, GQ344817, and GQ344818) and Syrah (GQ344819, GQ344820, GQ344821, and GQ344822), and three from Lemberger (GQ344812, GQ344813, and GQ344814) showed 87 to 100% identity at the nucleotide level and 92 to 100% identity at the amino acid level. A pairwise comparison of HSP-70 sequences of GLRaV-3 isolates from Idaho with corresponding sequences of GLRaV-3 isolates from GenBank showed nucleotide sequence identities between 88% (AJ748519) and 100% (DQ780885). Phylogenetic analysis of HSP-70 sequences from Idaho and GenBank showed clustering of Idaho sequences into five groups, with 12 sequences clustering with a Washington isolate (DQ780885), six sequences in a second group clustering with an isolate from Tunisia (AJ748522), two sequences in a third group clustering with an isolate from Austria (AJ748513), and one sequence each in groups four and five clustering with isolates from Italy (AJ748520) and Washington (DQ780889), respectively. The clustering was not cultivar- or vineyard-specific, suggesting separate introductions of different GLRaV-3 isolates in planting materials. To our knowledge, this is the first report of GLRaV-3 in grapevines grown in Idaho. These and previous results (1,2), indicate the wide distribution of GLRaV-3 in several grapevine cultivars in the Pacific Northwest Region. References: (1) R. R. Martin et al. Plant Dis. 89:763, 2005. (2) R. A. Naidu et al. (Abstr.) Phytopathology 96(suppl.):S83, 2006. (3) M. J. Soule et al. Plant Dis. 90:1461, 2006.

Monitoring of Drosophila suzukii (Diptera: Drosophilidae) in Okanagan Valley vineyards, British Columbia, Canada, and assessment of damage to table and wine grapes (Vitaceae)

2020 ◽  
Vol 152 (4) ◽  
pp. 415-431
Author(s):  
Susanna Acheampong ◽  
Etienne Lord ◽  
D. Thomas Lowery
Keyword(s):  
British Columbia ◽  
Weather Conditions ◽  
Wine Grape ◽  
Drosophila Suzukii ◽  
Wine Grapes ◽  
Apple Cider ◽  
Table Grapes ◽  
Soft Fruit ◽  
Grape Cultivars ◽  
Okanagan Valley

AbstractSpotted-wing drosophila, Drosophila suzukii, (Matsumura) (Diptera: Drosophilidae), has become a serious pest of soft fruit in the Okanagan Valley of British Columbia, Canada since its detection in 2009. The study was conducted to determine the distribution of D. suzukii and damage levels in grapes. Apple cider vinegar-baited traps placed in table and wine grape (Vitis vinifera Linnaeus; Vitaceae) vineyards during 2011–2013 demonstrated that D. suzukii was numerous in all sites, with earliest emergence and highest numbers recorded in 2013. Drosophila suzukii were reared from intact and damaged table grapes and damaged wine grapes collected from the field, but not from intact wine grapes. Drosophila suzukii were reared in low numbers in 2011 from intact fruit of 11 wine grape cultivars exposed artificially in the laboratory. Susceptibility of intact wine grapes under laboratory conditions in 2011 when sour rot was widespread might relate in part to undetected infections of berries due to weather conditions. Identification of Drosophila Fallén species revealed that D. suzukii comprised a small portion of the total. Our results demonstrate that healthy wine grapes in the Okanagan Valley of British Columbia are largely undamaged by D. suzukii, while certain table grape cultivars should be protected from attack.

scholarly journals First Report of Grapevine leafroll associated virus-3 in American Vitis spp. Grapevines in Washington State

Plant Disease ◽  
2006 ◽  
Vol 90 (11) ◽  
pp. 1461-1461 ◽  
Author(s):  
M. J. Soule ◽  
K. C. Eastwell ◽  
R. A. Naidu
Keyword(s):  
New York ◽  
Economic Impact ◽  
Virus Disease ◽  
The United States ◽  
Washington State ◽  
The State ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Table Grapes

Washington State is the largest producer of juice grapes (Vitis labruscana ‘Concord’ and Vitis labrusca ‘Niagara’) and ranks second in wine grape production in the United States. Grapevine leafroll disease (GLD) is the most wide spread and economically significant virus disease in wine grapes in the state. Previous studies (2) have shown that Grapevine leafroll associated virus-3 (GLRaV-3) is the predominant virus associated with GLD. However, little is known about the incidence and economic impact of GLD on juice and table grapes. Because typical GLD symptoms may not be obvious among these cultivars, the prevalence and economic impact of GLD in Concord and Niagara, the most widely planted cultivars in Washington State, has received little attention from the grape and nursery industries. During the 2005 growing season, 32 samples from three vineyards and one nursery of ‘Concord’ and three samples from one nursery of ‘Niagara’ were collected randomly. Petiole extracts were tested by single-tube reverse transcription-polymerase chain reaction (RT-PCR; 3) with primers LC 1 (5′-CGC TAG GGC TGT GGA AGT ATT-3′) and LC 2 (5′-GTT GTC CCG GGT ACC AGA TAT-3′), specific for the heat shock protein 70 homologue (Hsp70h gene) of GLRaV-3 (GenBank Accession No. AF037268). One ‘Niagara’ nursery sample and eleven ‘Concord’ samples from the three vineyards tested positive for GLRaV-3, producing a single band of the expected size of 546 bp. The ‘Niagara’ and six of the ‘Concord’ RT-PCR products were cloned in pCR2.1 (Invitrogen Corp, Carlsbad, CA) and the sequences (GenBank Accession Nos. DQ780885, DQ780886, DQ780887, DQ780888, DQ780889, DQ780890, and DQ780891) compared with the respective sequence of a New York isolate of GLRaV-3 (GenBank Accession No. AF037268). The analysis revealed that GLRaV-3 isolates from ‘Concord’ and ‘Niagara’ share nucleotide identities of 94 to 98% and amino acid identities and similarities of 97 to 98% with the Hsp70h gene homologue of the New York isolate of GLRaV-3. Additional testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antibodies specific to GLRaV-3 (BIOREBA AG, Reinach, Switzerland) further confirmed these results in the ‘Niagara’ and two of the ‘Concord’ isolates. GLRaV-3 has previously been reported in labrusca cvs. Concord and Niagara in western New York (4) and Canada (1), but to our knowledge, this is the first report of GLRaV-3 in American grapevine species in the Pacific Northwest. Because wine and juice grapes are widely grown in proximity to each other in Washington State and grape mealybug (Pseudococcus maritimus), the putative vector of GLRaV-3, is present in the state vineyards, further studies will focus on the role of American grapevine species in the epidemiology of GLD. References: (1) D. J. MacKenzie et al. Plant Dis. 80:955, 1996. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Rowhani et al. ICGV, Extended Abstracts, 13:148, 2000. (4) W. F. Wilcox et al. Plant Dis. 82:1062, 1998.

scholarly journals First Report of Grapevine Pinot gris virus (GPGV) in grapevine in France

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 293-293 ◽  
Author(s):  
M. Beuve ◽  
T. Candresse ◽  
M. Tannières ◽  
O. Lemaire
Keyword(s):  
Large Scale ◽  
De Novo ◽  
Pinot Noir ◽  
Rt Pcr ◽  
Wine Quality ◽  
First Report ◽  
Italian Isolate ◽  
Pcr Products ◽  
Grapevine Pinot Gris Virus ◽  
Plant Pathol

Grapevine Pinot gris virus (GPGV), belonging to the genus Trichovirus of the family Betaflexiviridae, was first identified by siRNA sequencing in northern Italy in 2012, in the grapevine varieties Pinot gris, Traminer, and Pinot Noir, which exhibited mottling and leaf deformation (1), and in asymptomatic vines, with a lower frequency. Since 2012, this virus has also been reported in South Korea, Slovenia, Greece (3), Czech Republic (2), Slovakia (2), and southern Italy (4). In 2014, GPGV was identified by Illumina sequencing of total RNAs extracted from leaves of the Merlot variety (Vitis vinifera) grafted onto Gravesac rootstock originated from a vineyard in the Bordeaux region of France. This Merlot plant exhibited fanleaf-like degeneration symptoms associated with Tomato black ring virus (TBRV) infection. Cuttings were collected in 2010 and maintained thereafter in a greenhouse. The full-length genome was assembled either de novo or by mapping of the Illumina reads on a reference GPGV genome (GenBank FR877530) using the CLC Genomics workbench software (CLC Bio, Qiagen, USA). The French GPGV isolate “Mer” (7,223 nucleotides, GenBank KM491305) is closely related to other European GPGV sequences; it exhibits 95.4% nucleotide identity with the reference Italian isolate (NC_015782) and 98 to 98.3% identity with Slovak isolates (KF134123 to KF134125). The higher divergence between French and Italian GPGV isolates was mainly due to differences in the 5′ extremity of the genome, as already shown with the Slovak GPGV isolates. RNA extracted from phloem scrapings of 19 cv. Merlot vines from the same plot collected in 2014 were analyzed by RT-PCR using the specific primer pair Pg-Mer-F1 (5′-GGAGTTGCCTTCGTTTACGA-3′) and Pg-Mer-R1 (5′-GTACTTGATTCGCCTC GCTCA-3′), designed on the basis of alignments of all available GPGV sequences from GenBank. The resulting amplicon of 770 bp corresponded to a fragment of the putative movement protein (MP) gene. Seven (35%) of the tested plants gave a strong positive amplification. Three RT-PCR products were directly sequenced and showed 99.3 to 99.5% identity within the MP gene of the GPGV-Mer isolate. Given the mixed viral infection status of the vines found infected by GPGV, it was not possible to associate a specific symptomatology with the presence of GPGV. Furthermore, similar RT-PCR tests were also performed on RNA extracts prepared from two plants of cv. Carignan that originated from a French grapevine collection, exhibiting fanleaf-like symptoms without any nepovirus detection. These samples similarly gave a strong positive amplification. The sequences obtained from the two Carignan vines showed 98.4 and 97.8% identity with the GPGV-Mer isolate. To our knowledge, this is the first report of GPGV in France. GPGV has been discovered in white and red berry cultivars, suggesting that its prevalence could be important in European vineyards (2). Further large-scale studies will be essential to determine the world prevalence of GPGV and to evaluate its potential effects on yield and on wine quality, as well as to shed light on GPGV epidemiology. Of particular concern is whether, like the other grapevine-infecting Trichovirus, Grapevine berry inner necrosis virus (GPGV) can be transmitted by the eryophid mite Colomerus vitis. References: (1) A. Giampetruzzi et al. Virus Res. 163: 262, 2012. (2) M. Glasa et al. Arch. Virol. 159: 2103, 2014. (3) G. P. Martelli, J. Plant Pathol. 96: S105, 2014. (4) M. Morelli et al. J. Plant Pathol. 96:431, 2014.

scholarly journals First Report of Grapevine leafroll-associated virus 2 in a Hybrid Grape ‘Vidal Blanc’ in Missouri

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 462-462 ◽  
Author(s):  
S. Lunden ◽  
W. Qiu
Keyword(s):  
New York ◽  
Leaf Roll ◽  
Late Summer ◽  
The United States ◽  
Coding Region ◽  
Rt Pcr ◽  
Protein Coding ◽  
First Report ◽  
Stem Lesions ◽  
Grape Cultivars

Grapevine leaf roll disease (GLRD) is one of the most prevalent viral diseases in vineyards worldwide. At least 10 Grapevine leafroll-associated viruses (GLRaV-1 to -7, and -9, -10, and -11) are associated with GLRD. GLRaV-2 has a number of distinct isolates that are associated not only with GLRD, but also with graft incompatibility, young vine decline, and rootstock stem lesions. In the United States, GLRaV-2 isolates have been reported in the states of California (4), New York (1), Oregon, and Washington (3). A survey of grapevine viruses was conducted on seven grape cultivars, Norton, Chambourcin, Chardonel, Vignoles, Vidal Blanc, Traminette, and Cayuga White, in a vineyard located at Mountain Grove, MO during the falls of 2009 and 2010 and late summer of 2011. Vines from each cultivar were assigned into three blocks. From each block, six individual vines were randomly selected. Phloem scrapings were collected for detecting viruses by ELISA and reverse-transcription (RT)-PCR. To test for GLRaV-2, a set of primers, GLRaV-2-Forward (5′-GGTGATAACCGACGCCTCTA, nt 6745 to 6764) and GLRaV-2-Reverse (5′-CCTAGCTGACGCAGATTGCT, nt 7268 to 7287), were designed from the coat protein coding region as reported previously (2). GRLaV-2 was detected only in the samples of ‘Vidal Blanc’. The detection of GLRaV-2 was further verified by ELISA using GRLaV-2-specific antisera (Bioreba AG, Reinach, Switzerland). The GLRaV-2-infected ‘Vidal Blanc’ vines did not exhibit visible symptoms. The RT-PCR amplified 543-bp cDNA fragments were isolated from agarose gel and cloned into the pCR2.1 vector (Invitrogen, Carlsbad, CA). Plasmid DNA was purified from three individual clones and sequenced from both directions. Comparison of the 543-bp sequences showed that the sequences shared 99% nt identity with the corresponding regions of 21 GLRaV-2 isolates, including PMC-083 isolate from Croatia (GenBank Accession No. HM185277), LN isolate from China (GenBank No. FJ786017), SE isolate from Brazil (GenBank No. EU204909), and four isolates from Washington (GenBank Nos. EU760836, 760838, 760843, and 760848). ‘Vidal Blanc’ is a white interspecific hybrid grape. Absence of visible symptoms on this cultivar emphasizes the importance of planting certified grapevines that have been indexed for viruses. Discovery of GLRaV-2 in asymptomatic white grape cultivars will warn growers on the potential damages and epidemics of GLRD in Midwest vineyards and promote planting clean grapevines. To our knowledge, this is the first report of GLRaV-2 in grapevines in Missouri. References: (1) M. Fuchs et al. Plant Dis. 93:395, 2009. (2) G. Gambino and I. Gribaudo. Phytopathology 96:1223, 2006. (3) R. R. Martin et al. Plant Dis. 89:763, 2005. (4) A. Rowhani et al. Phytopathology (Abstr.) 92:(suppl.):S71, 2002.

scholarly journals First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Plant Disease ◽  
2021 ◽  
Author(s):  
Dong Xu ◽  
Charith Raj Adkar-Purushothama ◽  
Pierre Lemoyne ◽  
Jean Pierre Perreault ◽  
Mamadou Fall
Keyword(s):  
Rna Extraction ◽  
Leaf Tissue ◽  
Positive Sequence ◽  
Wine Grape ◽  
Library Preparation ◽  
Rt Pcr ◽  
Tissue Samples ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

scholarly journals First Report of Avocado sunblotch viroid in Avocado from Michoacán, México

Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 202-202 ◽  
Author(s):  
R. De La Torre-A ◽  
D. Téliz-Ortiz ◽  
V. Pallás ◽  
J. A. Sánchez-Navarro
Keyword(s):  
Blot Analysis ◽  
The State ◽  
Persea Americana ◽  
Rt Pcr ◽  
Dot Blot ◽  
First Report ◽  
Deep Yellow ◽  
Hass Avocado ◽  
Dot Blot Analysis ◽  
Avocado Sunblotch Viroid

The State of Michoacán, México cultivates approximately 100,000 ha of avocados (Persea americana M.) (4). During a survey from 2006 to 2007 in cv. Hass avocado groves in Tingambato County, in the State of Michoacán, deep yellow spots and streaks, which sometimes became necrotic or reddish, were observed on the skin of fruits and the pulp of the fruit also showed big yellow spots. Some young shoots developed fine, yellow streaks, and leaves of symptomatic trees sometimes showed irregular, white-to-yellow spots. These symptoms were similar to those recorded for Avocado sunblotch viroid (ASBVd) (3). To determine if ABSVd was associated with these symptoms, total RNA extracted (1) from the skin and pulp of symptomatic and asymptomatic fruits and also from leaves and bark of shoots from five trees collected in a commercial plot in Tingambato County was tested by a one-step reverse transcription (RT)-PCR protocol using one primer pair to amplify specifically the complete ASBVd genome sequence (3). All 30 samples of skin and pulp of fruits, leaves, and cortex of shoots from symptomatic trees yielded two PCR fragments with estimated sizes of 250 and 500 base pairs (bp) corresponding to the putative monomeric and dimeric forms of ASBVd, respectively. The 500-bp RT-PCR fragments obtained from the different samples were purified from an agarose gel and cloned. The 249-bp nucleotide sequence of the ASBVd genomic monomer was determined using the clones from the fruit skin from sample Arb No. 3 (GenBank Accession No. EU888588), pulp from sample Arb No. 5 (GenBank Accession No. EU888590), leaves from samples Arb No. 15 (GenBank Accession No. EU888589) and Arb No. 8 (GenBank Accession Nos. EU888591 and EU888592), and cortex of shoots from sample Arb No. 16 (GenBank Accession Nos. EU888593, EU888594, EU888595, EU888596, and EU888597). BLAST analysis of the ASBVd sequences showed a range of 98 to 100% nucleotide identity to ASBVd sequences (GenBank Accession Nos. AF404064, AF404051, or AF229821). A clone of the Michoacán ASBVd (GenBank Accession No. EU888593) was used to synthesize a Dig-High Prime-UTP-T7 (Roche, Mannheim, Germany) fluorescent riboprobe complementary to the ASBVd plus strand to perform a dot-blot analysis as described previously (2). All ASBVd samples positive by RT-PCR gave a strong signal in the dot-blot analysis. This riboprobe will be used to index the ASBVd in other commercial avocado groves in Michoacán. To our knowledge, this is the first report of ASBVd in Michoacán, México. References: (1) D. J. Mackenzie et al. Plant Dis. 81:222, 1997. (2) J. A. Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) R. J. Schnell et al. Plant Dis. 81:1023, 1997. (4) D. Téliz and A. Mora. El aguacate y su Manejo Integrado. Mundiprensa, Mexico City, 2007.

scholarly journals First Report of Brown Rot in Wine Grapes Caused by Monilinia fructicola in Canada

Plant Disease ◽  
2003 ◽  
Vol 87 (10) ◽  
pp. 1268-1268 ◽  
Author(s):  
P. L. Sholberg ◽  
P. D. Haag ◽  
S. Hambleton ◽  
H. Boulay
Keyword(s):  
Vitis Vinifera ◽  
Sequence Data ◽  
Brown Rot ◽  
Plant Diseases ◽  
Pinot Noir ◽  
Rrna Genes ◽  
Monilinia Fructicola ◽  
Its Sequence ◽  
Wine Grapes ◽  
First Report

A survey was conducted in 2001 and 2002 to determine incidence of fruit pathogens in wine grapes (Vitis vinifera), an important crop in the southern interior of British Columbia (BC), Canada. Grape clusters were sampled every 2 weeks from June to October at eight vineyard sites located from Osoyoos in the south to Kelowna, approximately 100 km to the north. In the laboratory, the berry clusters were surface disinfested for 0.5 min in 70% ethanol, followed by 1 min in 0.5% sodium hypochlorite, and rinsed twice in sterile distilled water. The berries were placed on potato dextrose agar (PDA) amended with 15 ml/liter of 85% lactic acid and incubated at 20°C for 1 week. During the 2002 survey, a fungus resembling Monilinia fructicola (G. Wint.) Honey was observed sporulating on immature ‘Pinot noir’ grapes from Kelowna that were sampled on 14 August. Later in the growing season, a similar fungus was detected on ‘Riesling’ grapes from Summerland sampled on 11 September. There was no evidence of brown rot near the vineyard in Kelowna, but diseased stonefruit were present near the vineyard in Summerland. Subsequent identification of the fungus from ‘Riesling’ as M. fructicola was based on morphological characters and DNA sequence data for the internal transcribed spacer (ITS) regions of the nuclear ribosomal rRNA genes. The sequenced isolate was deposited in the Canadian Collection of Fungus Cultures as DAOM 231119, and the ITS sequence was accessioned in GenBank as AY289185. Colony growth on PDA was rapid and in concentric rings with the colony margin complete, microconidia abundant, and macroconidia 12 to 13 μm long. Macroconidia germinated with a long germ tube before branching. These characteristics distinguished this fungus from M. laxa, a closely related species that is slow growing with lobed colony margins, produces few microconidia, and germ tubes that branch close to the conidium (1). The complete ITS sequence for DAOM 231119 was a 100% match to other sequences deposited for M. fructicola (Z73777, AF010500, and U21815). On the basis of comparisons of available data, ITS sequences for M. fructicola (three complete ITS, seven partial ITS) and M. laxa (8 complete ITS, 10 partial ITS) differed consistently at four nucleotide positions. The fungus identified as M. fructicola was tested for pathogenicity on mature surface-sterilized ‘Pinot noir’ and ‘Riesling’ grapes. Under humid conditions, buff-colored sporodochia bearing conidia developed over the surface of the infected berries. This indicates that M. fructicola can cause decay of wine grapes and could be confused with bunch rot caused by Botrytis cinerea. Previously, M. fructicola was reported on grapes in Oklahoma, but likely these grapes were not Vitis vinifera (2). To our knowledge, this is the first report of brown rot caused by M. fructicola on wine grapes in North America. References: (1) L. R. Batra. World Species of Monilinia (Fungi): Their Ecology, Biosystematics and Control. Mycologia Memoir No. 16. Gerbrüder Borntraeger, Berlin/Stuttgart, 1991. (2) D. A. Preston. Host Index of Oklahoma Plant Diseases, Tech. Bull. No. 21. Oklahoma Agricultural and Mechanical College, Agricultural Experiment Station, Stillwater, 1945.

Sign in / Sign up

Export Citation Format

Share Document