Bacterial Soft Rot of Oncidium Orchids Caused by a Dickeya sp. (Pectobacterium chrysanthemi) in Florida

Oncidium orchids have been subjected to extensive cultivation in the pot-plant and cut flower industries because of their attractive and numerous flowers. In August 2008, approximately 50 Oncidium ‘Gower Ramsey’ orchids were discovered at a commercial orchid nursery in South Florida with brown, macerated leaves typical of soft rot disease reported in other orchids. Ten plants were selected, and sections were removed from the edge of symptomatic tissue and bacteria were isolated according to the method described by Schaad et al. (3). All isolates were gram negative, anaerobic, degraded pectate, grew at 37°C, produced blue-to-brown pigment on nutrient agar-glycerol-manganese chloride (NGM) medium (1), were sensitive to erythromycin, oxidase negative, and positive for phosphatase and indole production. Further analyses were performed on four of the isolates. MIDI analysis (Sherlock version TSBA 4.10; Microbial Identification, Newark, DE) identified the isolates as Erwinia chrysanthemi (SIM 0.880 to 0.929). Polymerase chain reactions were performed with the 16S primers 27f and 1495r (4) and 1,423 bp of the 16S rDNA gene showed 98 to 99% sequence identity to Pectobacterium chrysanthemi (GenBank Accession No. FM946179). Sequences were deposited in GenBank (Nos. HQ287572–HQ287575). Pathogenicity tests were performed by injecting 10 Oncidium ‘Gower Ramsey’ orchids with 100 μl of a bacterial suspension at 1 × 108 CFU/ml. Ten plants were inoculated with 100 μl of sterile water as controls. Plants were placed in a greenhouse at 26.0°C to 30.0°C and 50 to 83% relative humidity. Soft rot symptoms were observed on all inoculated plants within 24 h while control plants appeared normal. A Dickeya sp. was reisolated and identified according to the method described above. Oncidium orchids are known to be highly susceptible to P. carotovora (= E. carotovora) and soft rot caused by P. carotovora is known to occur frequently on Oncidium orchids (2). Although, an Erwinia sp. has been reported to cause soft rot symptoms on Oncidium aureum, to our knowledge, this is the first report of a Dickeya sp. (= P. chrysanthemi) causing soft rot symptoms on Oncidium orchids grown in large-scale commercial production in the United States. References: (1) Y. A. Lee and C. P. Yu. J. Microbiol. Methods 64:200, 2006. (2) C. H. Liau et al. Transgenic Res. 12:329, 2003. (3) N. W. Schaad et al. Erwinia soft rot group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (4) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Download Full-text

First Report of a Bacterial Soft Rot on Tolumnia Orchids Caused by a Dickeya sp. in the United States

Plant Disease ◽

10.1094/pdis-93-12-1354b ◽

2009 ◽

Vol 93 (12) ◽

pp. 1354-1354 ◽

Cited By ~ 8

Author(s):

R. A. Cating ◽

A. J. Palmateer ◽

R. T. McMillan ◽

E. R. Dickstein

Keyword(s):

Pathogenic Bacteria ◽

Soft Rot ◽

The United States ◽

South Florida ◽

Nutrient Agar ◽

Bacterial Suspension ◽

Brown Pigment ◽

Rrna Gene ◽

University Of Florida ◽

First Report

Tolumnia orchids are small epiphytic orchids grown for their attractive flowers. In the fall of 2008, approximately 100 Tolumnia orchids with soft, brown, macerated leaves were brought to the University of Florida Extension Plant Diagnostic Clinic in Homestead. Ten plants were randomly selected and bacteria were isolated from the margins of symptomatic tissues of each of the 10 plants on nutrient agar according to the method described by Schaad et al. (2). Four reference strains were used in all tests, including the molecular tests: Erwinia carotovora subsp. carotovora (obtained from J. Bartz, Department of Plant Pathology, University of Florida, Gainesville), E. chrysanthemi (ATCC No. 11662), Pectobacterium cypripedii (ATCC No. 29267), and Acidovorax avenae subsp. cattleyae (ATCC No. 10200). All 10 of the isolated bacteria were gram negative, grew at 37°C, degraded pectate in CVP (crystal violet pectate) medium, grew anaerobically, produced brown pigment on NGM (nutrient agar-glycerol-manganese chloride) medium (1), were sensitive to erythromycin, and produced phosphatase. Three of the strains were submitted for MIDI analysis (Sherlock version TSBA 4.10; Microbial Identification, Newark DE) (SIM 0.732 to 0.963), which identified them as E. chrysanthemi. A PCR assay was performed on the 16S rRNA gene with primers 27f and 1495r described by Weisburg et al. (3) from two of the isolates and a subsequent GenBank search showed 99% identity of the 1,508-bp sequence to that of Dickeya chrysanthemi (Accession No. FM946179) (formerly E. chrysanthemi). The sequences were deposited in GenBank (Accession Nos. GQ293897 and GQ293898). Pathogenicity was confirmed by injecting approximately 100 μl of a bacterial suspension at 1 × 108 CFU/ml into leaves of 10 Tolumnia orchid mericlones. Ten plants were also inoculated with water as controls. Plants were placed in a greenhouse at 29°C with 60 to 80% relative humidity. Within 24 h, soft rot symptoms appeared on all inoculated leaves. The water controls appeared normal. A Dickeya sp. was reisolated and identified using the above methods (biochemical tests and MIDI), fulfilling Koch's postulates. To our knowledge, this is the first report of a soft rot caused by a Dickeya sp. on Tolumnia orchids. Although 16S similarity and MIDI results suggest the isolated bacteria are D. chrysanthemi because of its close similarity with other Dickeya spp., these results are not conclusive. Further work should be conducted to confirm the identity of these isolates. Through correspondence with South Florida Tolumnia growers, it appears this disease has been a recurring problem, sometimes affecting international orchid shipments where plant losses have been in excess of 70%. References: (1) Y. A. Lee and C. P. Yu. J. Microbiol. Methods 64:200, 2006. (2) N. W. Schaad et al. Erwinia soft rot group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. American Phytopathological Society. St. Paul, MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Download Full-text

First Report of Bacterial Soft Rot on Vanda Orchids Caused by Dickeya chrysanthemi (Erwinia chrysanthemi) in the United States

Plant Disease ◽

10.1094/pdis-92-6-0977a ◽

2008 ◽

Vol 92 (6) ◽

pp. 977-977 ◽

Cited By ~ 6

Author(s):

R. A. Cating ◽

J. C. Hong ◽

A. J. Palmateer ◽

C. M. Stiles ◽

E. R. Dickstein

Keyword(s):

Pathogenic Bacteria ◽

Soft Rot ◽

The United States ◽

Erwinia Chrysanthemi ◽

Disease Spread ◽

Rrna Gene ◽

Bacterial Disease ◽

Water Control ◽

First Report ◽

Microbial Identification

Vanda orchids are epiphytes grown for their attractive flowers by commercial producers and hobbyists throughout Florida. In August 2007, five Vanda hybrids, with an economic value of $150 each, were found at a nursery in central Florida with leaves that were macerated, brown, and water soaked. According to the growers, the plants were normal the previous day but symptoms developed rapidly. The plants were immediately removed from the greenhouse to prevent potential disease spread. Bacteria were isolated according to the method of Schaad et al. (1). Isolated bacteria grew at 37°C, were gram negative, degraded pectate, and produced phosphatase. MIDI (Sherlock version TSBA 4.10; Microbial Identification 16 System, Newark, DE) (SIM 0.906) identified the bacteria as Erwinia chrysanthemi (Dickeya chrysanthemi Burkholder et al. 1953) Samson et al. 2005. PCR was performed on the 16S rRNA gene (GenBank Accession No. EU526397) with primers 27f (5′-GAGAGTTTGATCCTG GCTCAG-3′) and 1495r (5′-TACGGCTACCTTGTTACGA-3′) (2). Subsequent DNA sequencing and GenBank search showed the isolated strain is 99% identical to that of Dickeya chrysanthemi. Four leaves each of six Vanda hybrids were inoculated by injecting approximately 150 μl of a bacteria suspension at 1 × 108 CFU/ml into each leaf. One plant was inoculated with water in each of four leaves. Plants were enclosed in plastic bags and returned to the greenhouse under 50% shade at 29°C day and 17°C night temperatures. Within 24 h, soft rot symptoms appeared on inoculated leaves. The water control appeared normal. D. chrysanthemi was reisolated and identified with the above method, thus Koch's postulates were fulfilled. To our knowledge, this is the first report of a soft rot caused by D. chrysanthemi on Vanda hybrids. Because of the popularity and high value of Vanda orchids, proper identification of this rapidly progressing bacterial disease is of great importance for the commercial producer and homeowner alike. References: (1) N. W. Schaad et al. Erwinia soft rot group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. American Phytopathological Society. St. Paul, MN, 2001. (2) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

Download Full-text

First Report of Aglaonema Bacterial Blight Caused by Erwinia chrysanthemi in Taiwan

Plant Disease ◽

10.1094/pd-90-1358a ◽

2006 ◽

Vol 90 (10) ◽

pp. 1358-1358 ◽

Cited By ~ 7

Author(s):

Y. C. Chao ◽

C. T. Feng ◽

W. C. Ho

Keyword(s):

Bacterial Blight ◽

Pathogenic Bacteria ◽

Soft Rot ◽

The United States ◽

Erwinia Chrysanthemi ◽

Blue Pigment ◽

Pcr Analysis ◽

Bacterial Suspension ◽

Pigment Synthesis ◽

First Report

Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5′ GCGGTTGTTCACCAGGTGTTTT 3′) and 5B (5′ ATGCACGCTACCTGGAAGTAT 3′) specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 108 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3). References: (1) R. S. Dickey and A. Kelman. Page 44 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988. (2) M. Goto and K. Matsumoto. Int. J. Syst. Bacteriol. 37:130, 1987. (3) L. A. McFadden. Plant Dis. Rep. 53:253. 1969. (4) M. G. Zhu. Ph.D. diss, National Chung Hsing University, Taichung, Taiwan, 1995.

Download Full-text

First Report of Acidovorax avenae subsp. avenae Causing Bacterial Leaf Stripe of Strelitzia nicolai

Plant Disease ◽

10.1094/pdis-03-11-0160 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1474-1474 ◽

Cited By ~ 2

Author(s):

T. E. Seijo ◽

N. A. Peres

Keyword(s):

Pathogenic Bacteria ◽

Fatty Acid Analysis ◽

South Florida ◽

Metabolic Phenotype ◽

Bacterial Suspension ◽

Rrna Gene ◽

First Report ◽

Plastic Bags ◽

Young Leaves ◽

Symptomatic Tissue

White bird of paradise (Strelitzia nicolai Regel & K. Koch) is a commonly grown ornamental in central and south Florida. Each summer of 2004 to 2007, a reoccurring disease was observed at a commercial nursery in central Florida. Diseased plants had brown, necrotic stripes between the lateral leaf veins, which usually appeared along the midvein and spread toward the leaf edge. Lesions developed on the youngest leaves as they emerged from the central whorl. During 2004 and 2005, 20 symptomatic leaves were sampled. A white, nonfluorescent bacterium was consistently isolated from symptomatic tissue. It induced a hypersensitive response (HR) on tomato, grew at 41°C, and was identified as a Acidovorax sp. based on fatty acid analysis and as Acidovorax avenae subsp. avenae by Biolog metabolic phenotype analysis (similarity 0.76 to 0.86). A partial 16S rRNA gene sequence (1,455 bp) (Accession No. EF418616) was identical to four sequences in the NCBI (National Center for Biotechnology Information) database: one from A. avenae subsp. avenae and three from A. avenae of undetermined subspecies. To confirm pathogenicity, a bacterial suspension (O.D590 = 0.1) was applied to fill the central whorl (~0.5 to 1 ml) of potted S. nicolai. Plants were incubated for 7 to 10 days inside plastic bags at ambient temperature. Plants were inoculated individually with five strains of A. avenae subsp. avenae, four from S. nicolai, and one from corn (ATCC19860). Two to nine plants per strain were inoculated in each experiment. All strains were tested at least twice and noninoculated control plants were included. Symptoms were reproduced on the emerging leaf of 50 to 100% of inoculated plants with all five A. avenae subsp. avenae strains. No symptoms were observed on the controls. The bacteria recovered from symptomatic tissue were confirmed to be A. avenae subsp. avenae. Corn seedlings were inoculated as described above, except that entire seedlings were sprayed. Water-soaked lesions along the length of older leaf blades developed in 4 to 7 days. Only the corn strain was pathogenic (>80% of seedlings symptomatic), indicating host specificity. To our knowledge, this is the first report of A. avenae subsp. avenae infecting S. nicolai. In 1971, Wehlburg (2) described the same symptoms on orange bird of paradise (S. reginae) as being caused by a nonfluorescent Pseudomonas sp. This report likely describes the same disease since the published description is consistent with symptoms caused by A. avenae subsp. avenae. The pathogen reported by Wehlburg (2) had one polar flagellum, reduced nitrate, produced oxidase and a HR, and utilized arabinose, but not sucrose or arginine, characteristics consistent with those of A. avenae subsp. avenae (1). The only difference was A. avenae subsp. avenae has a delayed positive starch hydrolysis (1), whereas Welhburg's strain was negative. This disease occurs mainly on young leaves when plants receive daily overhead irrigation. Incidence can be as high as 40%, occasionally causing mortality, but even mild symptoms affect appearance and reduce marketability as an ornamental. References: (1) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) C. Wehlburg. Plant Dis. Rep. 55:447, 1971.

Download Full-text

First Report of Pectobacterium carotovorum subsp. carotovorum Causing Soft Rot of Orostachys japonica in Korea

Plant Disease ◽

10.1094/pdis-10-13-1039-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 989-989 ◽

Cited By ~ 2

Author(s):

W. Cheon ◽

Y. H. Jeon

Keyword(s):

16S Rrna ◽

Pathogenic Bacteria ◽

Sequence Similarity ◽

Soft Rot ◽

Bacterial Suspension ◽

Pectobacterium Carotovorum ◽

First Report ◽

Biolog System ◽

Carotovorum Subsp ◽

Physiological Tests

Orostachys japonica (Maxim) A. Berger is an important traditional medicine in Korea. The extract of this plant has antioxidant activity and suppresses cancer cell proliferation (1). From summer through fall of 2012 and 2013, a high incidence (~10% to 30%) of disease outbreaks of all plants characterized by water-soaked lesions and soft rot with a stinky odor was observed in cultivated O. japonica around Uljin (36°59′35.04″N, 126°24′1.51″E), Korea. Water-soaked lesions were first observed on the stem base of plants. Subsequently, the plants collapsed, although the upper portion remained asymptomatic. Thereafter, the lesions expanded rapidly over the entire plant. To isolate potential pathogens from infected leaves, small sections (5 to 10 mm2) were excised from the margins of lesions. Ten bacteria were isolated from ten symptomatic plants. Three representative isolates from different symptomatic plants were used for identification and pathogenicity tests. Isolated bacteria were gram negative, pectolytic on crystal violet pectate agar, nonfluorescent on King's medium B, and elicited a hypersensitive response in tobacco plants. All isolates caused soft rot of potato tubers. These isolates also differed from isolates of Erwinia chrysanthemi (Ech) that they were insensitive to erythromycin and did not produce phosphatase. These isolates differed from known strains of E. carotovora subsp. atroseptica in that they did not produce reducing substances from sucrose (2). Use of the Biolog GN microplate and the Release 4.0 system identified the isolate as Pectobacterium carotovorum subsp. carotovorum with 81.2% similarity. The 16S rRNA of the isolated bacteria was amplified by PCR and sequenced as described by Weisburg et al. (3). A BLAST analysis for sequence similarity of the 16S rRNA region revealed 99% similarity with nucleotide sequences for P. carotovorum subsp. carotovorum isolates (KC790305, KC790280, JF926758, JX196705, and AB680074). The pathogenicity of three bacterial isolates was examined on three 2-year-old O. japonica plants by adding 50 μl of a bacterial suspension containing 108 CFU/ml when wounding the leaves with sterile needles. Ten control plants were inoculated with sterilized water. After inoculation, plants were maintained in a growth chamber at 25°C with relative humidity ranging from 80 to 90%. After 2 to 3 days, tissue discoloration, water-soaked lesions, and soft rot developed around the inoculation point. Severe symptoms of soft rot and darkening developed on leaves of inoculated plants within 3 to 5 days after inoculation. All controls remained healthy during these experiments. The bacterial strains re-isolated from the parts of the leaf showing the symptoms and identified as P. carotovorum subsp. carotovorum on the basis of the biochemical and physiological tests, as well as Biolog system. The results obtained for pathogenicity, Biolog analysis, and molecular data corresponded with those for P. carotovorum subsp. carotovorum. To our knowledge, this is the first report of the presence of P. carotovorum on O. japonica in Korea. References: (1) C.-H. Kim et al. Kor. J. Med. Crop Sci. 11:31, 2003. (2) N. W. Schaad et al. Erwinia Soft Rot Group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al. eds. American Phytopathological Society, St. Paul. MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

Download Full-text

First Report of a Soft Rot of Phalaenopsis aphrodita Caused by Dickeya dieffenbachiae in China

Plant Disease ◽

10.1094/pdis-11-11-0942 ◽

2012 ◽

Vol 96 (5) ◽

pp. 760-760 ◽

Cited By ~ 8

Author(s):

J. N. Zhou ◽

B. R. Lin ◽

H. F. Shen ◽

X. M. Pu ◽

Z. N. Chen ◽

...

Keyword(s):

16S Rdna ◽

Large Scale ◽

Soft Rot ◽

The Philippines ◽

Gyrb Gene ◽

Bacterial Suspension ◽

Sterile Water ◽

Gene Sequences ◽

First Report ◽

Tropical Asia

Phalaenopsis orchids, originally from tropical Asia, are mainly planted in Thailand, Singapore, Malaysia, the Philippines, and Taiwan and have gained popularity from consumers all over the world. The cultivation area of Phalaenopsis orchids has been rising and large-scale bases have been established in mainland China, especially South China because of suitable environmental conditions. In September 2011, a soft rot of Phalaenopsis aphrodita was found in a Phalaenopsis planting base in Guangzhou with an incidence of ~15%. Infected plants initially showed water-soaked, pale-to-dark brown pinpoint spots on leaves that were sometimes surrounded by a yellow halo. Spots expanded rapidly with rising humidity and temperatures, and in a few days, severely extended over the blade with a light tan color and darker brown border. Lesions decayed with odorous fumes and tissues collapsed with inclusions exuding. The bacterium advanced to the stem and pedicle. Finally, leaves became papery dry and the pedicles lodged. Six diseased samples were collected, and bacteria were isolated from the edge of symptomatic tissues after sterilization in 0.3% NaOCl for 10 min, rinsing in sterile water three times, and placing on nutrient agar for culture. Twelve representative isolates were selected for further characterization. All strains were gram negative, grew at 37°C, were positive for indole production, and utilized malonate, glucose, and sucrose but not glucopyranoside, trehalose, or palatinose. Biolog identification (version 4.20.05, Hayward, CA) was performed and Pectobacterium chrysanthemi (SIM 0.868) was confirmed for the tested isolates (transfer to genus Dickeya). PCR was used to amplify the 16S rDNAgene with primers 27f and 1492r, dnaX gene with primers dnaXf and dnaXr (3), and gyrB gene with primers gyrBf (5′-GAAGGYAAAVTKCATCGTCAGG-3′) and gyrB-r1 (5′-TCARATATCRATATTCGCYGCTTTC-3′) designed on the basis of the published gyrB gene sequences of genus Dickeya. BLASTn was performed online, and phylogeny trees (100% bootstrap values) were created by means of MEGA 5.05 for these gene sequences, respectively. Results commonly showed that the representative tested strain, PA1, was most homologous to Dickeya dieffenbachiae with 98% identity for 16S rDNA(JN940859), 97% for dnaX (JN989971), and 96% for gyrB (JN971031). Thus, we recommend calling this isolate D. dieffenbachiae PA1. Pathogenicity tests were conducted by injecting 10 P. aphrodita seedlings with 100 μl of the bacterial suspension (1 × 108 CFU/ml) and another 10 were injected with 100 μl of sterile water as controls. Plants were inoculated in a greenhouse at 28 to 32°C and 90% relative humidity. Soft rot symptoms were observed after 2 days on the inoculated plants, but not on the control ones. The bacterium was isolated from the lesions and demonstrated identity to the inoculated plant by the 16S rDNA sequence comparison. Previously, similar diseases of P. amabilis were reported in Tangshan, Jiangsu, Zhejiang, and Wuhan and causal agents were identified as Erwinia spp. (2), Pseudomonas grimontii (1), E. chrysanthemi, and E. carotovora subsp. carovora (4). To our knowledge, this is the first report of D. dieffenbachiae causing soft rot disease on P. aphrodita in China. References: (1) X. L. Chu and B. Yang. Acta Phytopathol. Sin. 40:90, 2010. (2) Y. M. Li et al. J. Beijing Agric. Coll. 19:41, 2004. (3) M. Sławiak et al. Eur. J. Plant Pathol. 125:245, 2009. (4) Z. Y. Wu et al. J. Zhejiang For. Coll. 27:635, 2010.

Download Full-text

Effects of large-scale poultry farms on aquatic microbial communities: A molecular investigation

Journal of Water and Health ◽

10.2166/wh.2006.0006 ◽

2006 ◽

Vol 4 (1) ◽

pp. 77-86 ◽

Cited By ~ 5

Author(s):

Joseph A. Ringbauer ◽

Joseph B. James ◽

Fred J. Genthner

Keyword(s):

Water Samples ◽

Bacterial Communities ◽

Pathogenic Bacteria ◽

Large Scale ◽

Denaturing Gradient Gel Electrophoresis ◽

Late Summer ◽

The United States ◽

Sampling Location ◽

Poultry Production ◽

Poultry Farms

The effects of large-scale poultry production operations on water quality and human health are largely unknown. Poultry litter is frequently applied as fertilizer to agricultural lands adjacent to large poultry farms. Run-off from the land introduces a variety of stressors into the surface waters including nutrients, antimicrobials and pathogenic bacteria. The Delaware, Maryland and Virginia (Delmarva) Peninsula has the highest concentration of broiler chickens per farm acre in the United States and provides an ideal location for studying the effects of stressors from poultry farms. We investigated potential effects by characterizing shifts in the structure of aquatic bacterial communities. DNA was isolated from microorganisms in water samples from streams and rivers at varying distances from, or having different frequencies of, litter applications. Fingerprints of 16S rDNA amplicons from bacteria in water samples collected during late summer 2001 to late spring 2002 were produced by denaturing gradient gel electrophoresis (DGGE). A statistical analysis of multiple fingerprints from each sampling location demonstrated that each site harboured a bacterial community significantly different from the communities at other sites. Similarly, the bacterial communities from each sampling time differed significantly from communities at other sampling times. Most importantly, a competitive, library-based analysis showed time of sampling (month) had a greater effect on community structure than did location.

Download Full-text

Wildfire of Soybean Caused by Pseudomonas syringae pv. tabaci, a New Disease in Korea

Plant Disease ◽

10.1094/pdis-93-11-1214a ◽

2009 ◽

Vol 93 (11) ◽

pp. 1214-1214 ◽

Cited By ~ 3

Author(s):

I.-S. Myung ◽

J.-W. Kim ◽

S. H. An ◽

J. H. Lee ◽

S. K. Kim ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Pathogenic Bacteria ◽

Similarity Index ◽

Soft Rot ◽

Universal Primers ◽

Identification System ◽

Bacterial Disease ◽

Bacterial Strains ◽

Microbial Identification ◽

Soybean Leaves

In 2006 and 2007, a new bacterial disease was observed in field-cultivated soybeans in Boeun District and Munkyung City of Korea. The disease caused severe blighting of soybean (Glycine max) leaves. Soybean leaves in fields showed yellowish spots with brown centers. Brown and dead areas of variable size and shape were surrounded by wide, yellow haloes with distinct margins. Spots might coalesce and affected leaves fell readily. Seven bacterial strains were isolated from chlorotic areas of soybean leaves and all produced white colonies on trypticase soy agar. With the Biolog Microbial Identification System, version 4.2, (Biolog Inc., Hayward, CA) all strains and Pseudomonas syringae pv. tabaci CFBP2106T were identified as P. syringae pv. tabaci with a Biolog similarity index of 0.28 to 0.52 and 0.48 after 24 h. Pathogenicity of the strains (three plants per strain) on soybean leaves at the V5 stage (cv. Hwanggeum) was confirmed by rub inoculation with bacterial suspensions (1 × 108 CFU/ml) in sterile distilled water on the lesions cut 1 cm long on the upper side of the leaves with razor blades and by pinprick on 3-week-old leaves of tobacco (Nicotiana tabacum cv. Samsun) in the greenhouse. Wildfire symptoms on the soybean leaves and faint halos on tobacco leaves were observed 4 days after inoculation. The identification of reisolated bacterial strains was confirmed with the metabolic fingerprintings on Biolog. LOPAT tests (1) and phenotypic characteristics (3) of the strains were similar to those of the CFBP2106T. Colonies were levan positive, oxidase negative, potato soft rot negative, arginine dihydrase negative, and tobacco hypersensitivity negative. All strains were gram-negative, aerobic rods with a polar flagellum. Strains were negative for esculin hydrolysis, gelatin liquefaction, urea production, accumulation of poly-β-hydroxy butyrate, starch hydrolysis, ornithine dihydrolase, lysine dihydrolase, growth at 37°C, utilization of geraniol, benzoate, cellobiose, sorbitol, trehalose, l-rhamnose, and adonitol. Positive reactions were catalase and arbutin hydrolysis, utilization of sorbitol, d-arabinose, and dl-serine. The strains were variable in utilization of mannitol, sucrose, and d-arabinose. The 1,472-bp PCR fragments of strains, BC2366 (GenBank Accession No. FJ755788) and BC2367 (No. FJ755789) was sequenced using 16S rDNA universal primers (2). The sequences shared 100% identity with the analogous sequences of P. syringae pv. glycenea (GenBank Accession No. AB001443) available in NCBI databases. Based on the phenotypic, genetic, and pathological characteristics, all strains were identified as P. syringae pv. tabaci. To our knowledge, this is the first report of P. syringae pv. tabaci causing wildfire on soybean in Korea. References: (1) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (2) I.-S. Myung et al. Plant Dis. 92:1472, 2008. (3) N. W. Schaad et al., eds. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001.

Download Full-text

First Report of Broccoli Soft Rot Caused by Pectobacterium carotovorum subsp. carotovorum in Serbia

Plant Disease ◽

10.1094/pdis-03-13-0258-pdn ◽

2013 ◽

Vol 97 (11) ◽

pp. 1504-1504 ◽

Cited By ~ 1

Author(s):

K. Gašic ◽

V. Gavrilović ◽

Ž. Ivanović ◽

A. Obradović

Keyword(s):

Pathogenic Bacteria ◽

Soft Rot ◽

Hypodermic Needle ◽

Bacterial Suspension ◽

Rrna Gene ◽

Pectobacterium Carotovorum ◽

Vegetable Crops ◽

Bacterial Strains ◽

Carotovorum Subsp ◽

Its Pcr

In September 2012, soft rot symptoms on broccoli (Brassica oleracea L. var. italica Plenck) were observed in several commercial fields in the western part of Serbia. Following the first harvest, water-soaked areas developed on broccoli stem tissue and progressed into soft rot decay of entire plants. The incidence of disease was approximately 30%. In Serbia, broccoli is grown on smaller fields compared to other vegetables, but its production and consumption increased significantly in recent years. From the diseased tissue, shiny, grayish white, round colonies were isolated on nutrient agar. Six non-fluorescent, gram-negative, facultative anaerobic, oxidase-negative, and catalase-positive bacterial strains were chosen for further identification. All strains caused soft rot on potato and carrot slices and did not induce hypersensitive reaction on tobacco leaves. They grew at 37°C and in yeast salts broth medium containing 5% NaCl (2), did not produce acid from α-methyl glucoside, but utilized lactose and trehalose, and did not produce indole or lecitinase. Investigated strains formed light red, 1.5-mm-diameter colonies on Logan's medium (2), and did not produce blue pigmented indigoidine on glucose yeast calcium carbonate agar (2) nor “fried egg” colonies on potato dextrose agar. Based on biochemical and physiological characteristics (1) and ITS-PCR and ITS-RFLP analysis (4), the strains were identified as Pectobacterium carotovorum subsp. carotovorum. The 16S rRNA gene sequence from two strains (GenBank KC527051 and KC527052) showed 100% identity with sequences of P. carotovorum subsp. carotovorum previously deposited in GenBank (3). Pathogenicity of the strains was confirmed by inoculation of broccoli head tissue fragments. Three florets per strain were inoculated by pricking the petals with a syringe and hypodermic needle and depositing a droplet of bacterial suspension (approx. 1 × 108 CFU/ml) at the point of inoculation. Sterile distilled water was used as a negative control. Inoculated florets were placed in a sealed plastic container and incubated in high humidity conditions at 28°C. Tissue discoloration and soft rot developed around the inoculation point within 48 to 72 h. No symptoms developed on control florets. Identity of bacterial strains reisolated from inoculated plant tissues was confirmed by ITS-PCR using G1/L1 primers followed by digestion of PCR products with Rsa I restriction enzyme (4). In Serbia, P. carotovorum subsp. carotovorum has been isolated from potato, some vegetable crops, and ornamentals, but not from broccoli until now. References: (1) S. H. De Boer and A. Kelman. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (2) P. C. Fahy and A. C. Hayward. Page 337 in: Plant Bacterial Diseases: A Diagnostic Guide. P. C. Fahy and G. J. Persley eds. Academic Press, New York, 1983. (3) S. Nabhan et al. J. Appl. Microbiol. 113: 904, 2012. (4) I. K. Toth et. al. Appl. Environ. Microbiol. 67:4070, 2001.

Download Full-text

First Report of Bacterial Blight Caused by Pseudomonas syringae pv. syringae on Common Vetch in Spain

Plant Disease ◽

10.1094/pdis-93-12-1348b ◽

2009 ◽

Vol 93 (12) ◽

pp. 1348-1348 ◽

Cited By ~ 4

Author(s):

A. Martín-Sanz ◽

J. L. Palomo ◽

C. Caminero

Keyword(s):

Pseudomonas Syringae ◽

Bacterial Blight ◽

Pathogenic Bacteria ◽

The United States ◽

Bacterial Suspension ◽

Citrus Limon ◽

Sterile Water ◽

Common Vetch ◽

First Report ◽

Castilla Y Leon

Common vetch (Vicia sativa L.) is an important legume crop used for livestock feed in the Mediterranean Area. This crop has an important role for sustainable agriculture in dryland rotations in Spain, where the Castilla y León Region is the major production area. During the springs of 2007 and 2008, necrotic lesions on stems, leaves, and flowers were observed in five different common vetch plots around Medina de Rioseco (Castilla y León). Four of the plots were sown with cv. Buza. No information was available about the cultivar in the fifth plot. In many cases, lesions had expanded into the stems causing complete wilting. Disease incidence was estimated at approximately 20%. Two symptomatic plants per plot were sampled. One section per plant was individually surface disinfested in 0.5% NaOCl for 1 min, followed by three washes in sterile water. Macerates were plated in King's B medium (KB) agar (24°C for 48 h) (2). Colonies from all isolations on KB agar were pale yellow and blue-green fluorescent under UV light, as typical of fluorescent Pseudomonas spp. (2). Ten isolates (one per section) were characterized. These were identified as Pseudomonas syringae by the LOPAT scheme (2) and Hugh-Leifson reaction and all utilized erythritol, l-lactate, and dl-homoserine, but not l(+)-tartrate, as carbon sources. They were positive for aesculin and gelatine hydrolysis. The 10 isolates caused severe necrotic lesions when they were puncture inoculated (108 CFU/ml suspension, 50 μl per wound, and two replicates) on immature lemon fruits (Citrus × limon, cv. Primofioro), bean pods (Phaseolus vulgaris L., cv. Ancha Lisa), and pea pods (Pisum sativum L., cv. Ucero). PCR amplification of a 752-bp syrB fragment (3) was positive for all isolates. On the basis of these tests, the 10 isolates were identified as P. syringae pv. syringae (2). Subsequently, each isolate was inoculated into two sets of 10 plants of V. sativa cv. Buza by injecting 200 μl of a bacterial suspension (108 CFU/ml) into the stem (2); 10 plants were injected with sterile water as controls. Ten days after inoculation, necrotic symptoms were observed on all plants, and 1 week later, all plants were completely wilted and dead. These symptoms were similar to those observed in the field. Control plants remained symptomless. Isolations were made from two inoculated plants per each original isolate, and all reisolates were identical to the original isolates in the above biochemical tests and PCR of the syrB gene. P. syringae pv. syringae reference strains, CFBP1768 and CFBP1769 (Collection Française de Bactéries Phytopathogènes), gave the same results in all biochemical, pathogenicity, and PCR tests. To our knowledge, this is the first report of bacterial blight caused by this pathogen on vetch in Spain. This pathogen had been previously identified in this crop in France (4) and in V. villosa (a closely related species) in the United States (1). Therefore, to prevent the spread of this pathogen, research on efficient preventive and control measures is needed. References: (1) G. L. Ercolani et al. Phytopathology 64:1330, 1974. (2) N. W. Schaad et al., eds. Laboratory Guide for the Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (3) K. N. Sorensen et al. Appl. Environ. Microbiol. 64:226, 1998. (4) C. Tourte and C. Manceau. Eur. J. Plant Pathol. 101:483, 1995.

Download Full-text