scholarly journals First Report of Acidovorax avenae subsp. avenae Causing Bacterial Leaf Stripe of Strelitzia nicolai

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1474-1474 ◽  
Author(s):  
T. E. Seijo ◽  
N. A. Peres
Keyword(s):  
Pathogenic Bacteria ◽  
Fatty Acid Analysis ◽  
South Florida ◽  
Metabolic Phenotype ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
First Report ◽  
Plastic Bags ◽  
Young Leaves ◽  
Symptomatic Tissue

White bird of paradise (Strelitzia nicolai Regel & K. Koch) is a commonly grown ornamental in central and south Florida. Each summer of 2004 to 2007, a reoccurring disease was observed at a commercial nursery in central Florida. Diseased plants had brown, necrotic stripes between the lateral leaf veins, which usually appeared along the midvein and spread toward the leaf edge. Lesions developed on the youngest leaves as they emerged from the central whorl. During 2004 and 2005, 20 symptomatic leaves were sampled. A white, nonfluorescent bacterium was consistently isolated from symptomatic tissue. It induced a hypersensitive response (HR) on tomato, grew at 41°C, and was identified as a Acidovorax sp. based on fatty acid analysis and as Acidovorax avenae subsp. avenae by Biolog metabolic phenotype analysis (similarity 0.76 to 0.86). A partial 16S rRNA gene sequence (1,455 bp) (Accession No. EF418616) was identical to four sequences in the NCBI (National Center for Biotechnology Information) database: one from A. avenae subsp. avenae and three from A. avenae of undetermined subspecies. To confirm pathogenicity, a bacterial suspension (O.D590 = 0.1) was applied to fill the central whorl (~0.5 to 1 ml) of potted S. nicolai. Plants were incubated for 7 to 10 days inside plastic bags at ambient temperature. Plants were inoculated individually with five strains of A. avenae subsp. avenae, four from S. nicolai, and one from corn (ATCC19860). Two to nine plants per strain were inoculated in each experiment. All strains were tested at least twice and noninoculated control plants were included. Symptoms were reproduced on the emerging leaf of 50 to 100% of inoculated plants with all five A. avenae subsp. avenae strains. No symptoms were observed on the controls. The bacteria recovered from symptomatic tissue were confirmed to be A. avenae subsp. avenae. Corn seedlings were inoculated as described above, except that entire seedlings were sprayed. Water-soaked lesions along the length of older leaf blades developed in 4 to 7 days. Only the corn strain was pathogenic (>80% of seedlings symptomatic), indicating host specificity. To our knowledge, this is the first report of A. avenae subsp. avenae infecting S. nicolai. In 1971, Wehlburg (2) described the same symptoms on orange bird of paradise (S. reginae) as being caused by a nonfluorescent Pseudomonas sp. This report likely describes the same disease since the published description is consistent with symptoms caused by A. avenae subsp. avenae. The pathogen reported by Wehlburg (2) had one polar flagellum, reduced nitrate, produced oxidase and a HR, and utilized arabinose, but not sucrose or arginine, characteristics consistent with those of A. avenae subsp. avenae (1). The only difference was A. avenae subsp. avenae has a delayed positive starch hydrolysis (1), whereas Welhburg's strain was negative. This disease occurs mainly on young leaves when plants receive daily overhead irrigation. Incidence can be as high as 40%, occasionally causing mortality, but even mild symptoms affect appearance and reduce marketability as an ornamental. References: (1) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) C. Wehlburg. Plant Dis. Rep. 55:447, 1971.

scholarly journals First Report of a Bacterial Soft Rot on Tolumnia Orchids Caused by a Dickeya sp. in the United States

Plant Disease ◽  
2009 ◽  
Vol 93 (12) ◽  
pp. 1354-1354 ◽  
Author(s):  
R. A. Cating ◽  
A. J. Palmateer ◽  
R. T. McMillan ◽  
E. R. Dickstein
Keyword(s):  
Pathogenic Bacteria ◽  
Soft Rot ◽  
The United States ◽  
South Florida ◽  
Nutrient Agar ◽  
Bacterial Suspension ◽  
Brown Pigment ◽  
Rrna Gene ◽  
University Of Florida ◽  
First Report

Tolumnia orchids are small epiphytic orchids grown for their attractive flowers. In the fall of 2008, approximately 100 Tolumnia orchids with soft, brown, macerated leaves were brought to the University of Florida Extension Plant Diagnostic Clinic in Homestead. Ten plants were randomly selected and bacteria were isolated from the margins of symptomatic tissues of each of the 10 plants on nutrient agar according to the method described by Schaad et al. (2). Four reference strains were used in all tests, including the molecular tests: Erwinia carotovora subsp. carotovora (obtained from J. Bartz, Department of Plant Pathology, University of Florida, Gainesville), E. chrysanthemi (ATCC No. 11662), Pectobacterium cypripedii (ATCC No. 29267), and Acidovorax avenae subsp. cattleyae (ATCC No. 10200). All 10 of the isolated bacteria were gram negative, grew at 37°C, degraded pectate in CVP (crystal violet pectate) medium, grew anaerobically, produced brown pigment on NGM (nutrient agar-glycerol-manganese chloride) medium (1), were sensitive to erythromycin, and produced phosphatase. Three of the strains were submitted for MIDI analysis (Sherlock version TSBA 4.10; Microbial Identification, Newark DE) (SIM 0.732 to 0.963), which identified them as E. chrysanthemi. A PCR assay was performed on the 16S rRNA gene with primers 27f and 1495r described by Weisburg et al. (3) from two of the isolates and a subsequent GenBank search showed 99% identity of the 1,508-bp sequence to that of Dickeya chrysanthemi (Accession No. FM946179) (formerly E. chrysanthemi). The sequences were deposited in GenBank (Accession Nos. GQ293897 and GQ293898). Pathogenicity was confirmed by injecting approximately 100 μl of a bacterial suspension at 1 × 108 CFU/ml into leaves of 10 Tolumnia orchid mericlones. Ten plants were also inoculated with water as controls. Plants were placed in a greenhouse at 29°C with 60 to 80% relative humidity. Within 24 h, soft rot symptoms appeared on all inoculated leaves. The water controls appeared normal. A Dickeya sp. was reisolated and identified using the above methods (biochemical tests and MIDI), fulfilling Koch's postulates. To our knowledge, this is the first report of a soft rot caused by a Dickeya sp. on Tolumnia orchids. Although 16S similarity and MIDI results suggest the isolated bacteria are D. chrysanthemi because of its close similarity with other Dickeya spp., these results are not conclusive. Further work should be conducted to confirm the identity of these isolates. Through correspondence with South Florida Tolumnia growers, it appears this disease has been a recurring problem, sometimes affecting international orchid shipments where plant losses have been in excess of 70%. References: (1) Y. A. Lee and C. P. Yu. J. Microbiol. Methods 64:200, 2006. (2) N. W. Schaad et al. Erwinia soft rot group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. American Phytopathological Society. St. Paul, MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Black Rot on Arugula Caused by Xanthomonas campestris pv. campestris in Argentina

Plant Disease ◽  
2008 ◽  
Vol 92 (6) ◽  
pp. 980-980 ◽  
Author(s):  
A. M. Romero ◽  
R. Zapata ◽  
M. S. Montecchia
Keyword(s):  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Biochemical Characterization ◽  
Bacterial Suspension ◽  
Black Rot ◽  
Strictly Aerobic ◽  
First Report ◽  
Plastic Bags ◽  
Water Plants ◽  
Xanthomonas Campestris Pv Campestris

During the fall of 2005, arugula (Eruca sativa Mill.) plants grown in experimental field plots in Buenos Aires, Argentina presented V-shaped necrotic lesions on leaf margins and blackened veins with broad yellow halos, followed by leaf necrosis. At flowering, 96% of the plants were affected with 27% of the leaves with symptoms. Yellow, round, mucoid, convex, bacterial colonies were isolated from several leaves on yeast dextrose chalk agar. Two strains were further studied. Xanthomonas campestris pv. campestris Xcc8004 was used as a control. Strains were gram negative, rod shaped, strictly aerobic, catalase-positive, oxidase and urease-negative, hydrolyzed starch, gelatine and aesculin, and did not reduce nitrate (2). Pathogenicity was tested by spraying 10 3-week-old arugula plants with either a bacterial suspension (107 CFU/ml) or sterile water. Plants were placed in plastic bags for 72 h after inoculation. All inoculated plants showed necrotic lesions enlarging from the margin of the leaves 7 days after inoculation. No lesions were observed on control plants. On the basis of biochemical characterization (2) and genomic fingerprints generated by BOX-PCR (1), the pathogen was identified as X. campestris pv. campestris. To our knowledge, this is the first report of X. campestris pv. campestris causing black rot on arugula in Argentina. References: (1) J. L. Rademaker et al. Int. J. Syst. Evol. Microbiol. 50:665, 2000. (2) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001.

scholarly journals First Report of Bacterial Canker on Blueberry (Vaccinium corymbosum) Caused by Pseudomonas syringae pv. syringae in Serbia

Plant Disease ◽  
2021 ◽  
Author(s):  
Nevena Zlatkovic ◽  
Goran Aleksić ◽  
Katarina Gašić
Keyword(s):  
Pseudomonas Syringae ◽  
Natural Infection ◽  
Vaccinium Corymbosum ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Highbush Blueberry ◽  
Bacterial Canker ◽  
First Report ◽  
Appl Environ ◽  
Symptomatic Tissue

During May 2021, necrosis of young twigs and flower buds were observed on two-year-old highbush blueberry plants (Vaccinium corymbosum) cv. Draper, in a 1 hectare orchard in the municipality of Šabac, Serbia. Disease symptoms included reddish-brown to black irregularly shaped cankers developing on the shoot tips that extended downwards along the branches. In some plants, cankers surrounded the stem, causing shoot-tip dieback and necrosis of the buds. Beneath the bark, a distinct margin between diseased and healthy tissue was visible. A few weeks before symptoms development, seven freezing events with temperature from -3°C to -1°C, and five near-freezing temperatures were recorded in this area, leading to the hypothesis that symptoms were associated to the presence of ice nucleating bacteria belonging to Pseudomonas syringae. The observed disease incidence was 80%, while 10% of the plants died. Bacteria were isolated from symptomatic tissue on King’s medium B (KB). After 2 to 3 days of incubation at 27°C, predominantly grey-whitish, shiny, round, convex bacterial colonies were observed on agar plates. Ten isolates producing a fluorescent pigment on KB were selected for further characterization by biochemical and molecular tests. The isolates were Gram, oxidase and arginine-dihydrolase negative, levan positive, induced hypersensitive response on tobacco leaves and showed no pectinolytic activity on potato slices. Based on the results of API 20E and API 20NE tests (BioMerieux, France), and the fact that isolates did not utilize tartrate nor had tyrosinase activity, they were preliminarly identified as Pseudomonas syrinage pv. syringae (Braun-Kiewnick and Sands 2001). Additionally, all tested isolates had ice-nucleation activity at -5°C. The syrB gene responsible for syringomycin synthesis, was amplified in all isoaltes with the specific primer pair B1/B2 (Sorensen et al. 1998). The 16S rRNA gene sequences of five selected isolates (GenBank MZ410287 to 91) showed 100% identity to P. s. pv. syringae isolated from Prunus avium in United Kingdom (GenBank CP026568) and France (GenBank LT962480). Sequences of gyrB gene (Sarkar and Guttman 2004) of two selected isolates (GenBank MZ420633 and MZ420634) showed 98,44% identity to the P. s. pv. syrinage strain isolated in France (GenBank LT962480). Pathogenicity of the isolates was confirmed on 2-year-old blueberry plants cv. Draper, by inoculating two plants per isolate. One-cm long wounds were made on branches using a scalpel and 20 µl of bacterial suspension (106 CFU/ml) was infiltrated into the tissue. The cuts were then covered with moist sterile cotton pads and wraped in parafilm for 3 days. Inoculation was also performed on two leaves per plant by needleless syringe infiltration (106 CFU/ml). Sterile distilled water was used as a negative control. Plants were maintained in greenhouse at 27°C day and 15°C night temperature. Three weeks after inoculation, the inoculated branches and leaves developed necrosis, leaves spots and cankers respectively, resembling the natural infection. Symptoms were not observed on the control plants. Bacteria were reisolated from symptomatic tissue and their identity was confirmed by amplifying the syrB gene sequence and additional biochemical tests. This is the first report of bacterial canker of highbush blueberry caused by P. s. pv. syringae in Serbia. In Europe, there was only one report on Pseudomonas spp. causing disease on blueberry leaves in Poland (Kaluzna et al. 2013). Due to market demands and export potential, blueberry production in Serbia has been rapidly increasing. In 2015, highbush blueberry was cultivated on 220 ha, while in 2020 the area increased to 1899 ha. However, under favourable environmental conditions, blueberry production might be severely affected by bacterial canker. References: Braun-Kiewnick, A. and Sands, D.C. Page 84 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. Kaluzna, M., et al. 2013. J Plant Protec Res 53:32. Sarkar, S. F., and Guttman, D. S. 2004. Appl. Environ. Microbiol. 70:1999. https://doi.org/10.1128 Sorensen, K. N., et al. 1998. Appl. Environ. Microbiol. 64:226.

scholarly journals First Report of Acidovorax avenae subsp. citrulli as a Pathogen of Gramma in Australia

Plant Disease ◽  
2002 ◽  
Vol 86 (12) ◽  
pp. 1406-1406 ◽  
Author(s):  
H. L. Martin ◽  
C. M. Horlock
Keyword(s):  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Bacterial Cells ◽  
Carbon Source Utilization ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Plastic Bags ◽  
Symptomatic Tissue ◽  
Polymerase Chain ◽  
Slow Growing

In March 2001, a foliar bacterial disease was observed on gramma seedlings (Cucurbita moschata L.) cv. Ken Special Hybrid 864 in a commercial nursery in Bowen, north Queensland, Australia. Symptoms included chlorosis of cotyledons and angular, water-soaked lesions from the tips of the cotyledons to the petioles. Brown, angular, water-soaked lesions that were delimited by the leaf veins were also present on newly emerged true leaves. Streaming of bacterial cells from the edges of cut lesions was seen in a droplet of water with ×100 magnification. Isolations attempted on King's medium B consistently yielded a slow-growing, cream to white, gram-negative bacterium. Bacterium was identified as Acidovorax avenae subsp. citrulli based on carbon source utilization profiles (Biolog, Hayward CA) and polymerase chain reaction (PCR) using a primer pair based on the 16S-23S internal transcribed spacer region. When tested in rep-PCR with the BoxA1R primer (2), the isolate produced a banding pattern similar to other Australian A. avenae subsp. citrulli isolates previously shown to be pathogenic to rockmelon (1). Koch's postulates were completed with 20 2-week-old glasshouse-grown gramma (cv. Ken Special Hybrid 864) seedlings. Seedlings were misted until runoff with a 3 × 108 CFU/ml bacterial suspension and enclosed in plastic bags for 48 h at 23°C. Water-soaked lesions developed on cotyledons of all seedlings 6 days after inoculation, and bacterium was reisolated from symptomatic tissue. To our knowledge, this is the first report of A. avenae subsp. citrulli as a pathogen of C. moschata References: (1) R. G. O'Brien and H. L. Martin. Aust. J. Exp. Agric. 39:479, 1999 (2) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

scholarly journals First Report of Leaf Blight and Stem Canker of Pachysandra terminalis Caused by Pseudonectria pachysandricola in Korea

Plant Disease ◽  
2012 ◽  
Vol 96 (2) ◽  
pp. 287-287
Author(s):  
K. S. Han ◽  
J. H. Park ◽  
S. E. Cho ◽  
H. D. Shin
Keyword(s):  
United States ◽  
Its Region ◽  
Stem Canker ◽  
The United States ◽  
Culture Collection ◽  
Leaf Blight ◽  
First Report ◽  
Cornell University ◽  
Plastic Bags ◽  
Young Leaves

Pachysandra terminalis Siebold & Zucc., known as Japanese pachysandra, is a creeping evergreen perennial belonging to the family Buxaceae. In April 2011, hundreds of plants showing symptoms of leaf blight and stem canker with nearly 100% incidence were found in a private garden in Suwon, Korea. Plants with the same symptoms were found in Seoul in May and Hongcheon in August. Affected leaves contained tan-to-yellow brown blotches. Stem and stolon cankers first appeared as water soaked and developed into necrotic lesions. Sporodochia were solitary, erumpent, circular, 50 to 150 μm in diameter, salmon-colored, pink-orange when wet, and with or without setae. Setae were hyaline, acicular, 60 to 100 μm long, and had a base that was 4 to 6 μm wide. Conidiophores were in a dense fascicle, not branched, hyaline, aseptate or uniseptate, and 8 to 20 × 2 to 3.5 μm. Conidia were long, ellipsoid to cylindric, fusiform, rounded at the apex, subtruncate at the base, straight to slightly bent, guttulate, hyaline, aseptate, 11 to 26 × 2.5 to 4.0 μm. A single-conidial isolate formed cream-colored colonies that turned into salmon-colored colonies on potato dextrose agar (PDA). Morphological and cultural characteristics of the fungus were consistent with previous reports of Pseudonectria pachysandricola B.O. Dodge (1,3,4). Voucher specimens were housed at Korea University (KUS). Two isolates, KACC46110 (ex KUS-F25663) and KACC46111 (ex KUS-F25683), were accessioned in the Korean Agricultural Culture Collection. Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced using ABI Prism 337 automatic DNA sequencer (Applied Biosystems, Foster, CA). The resulting sequence of 487 bp was deposited in GenBank (Accession No. JN797821). This showed 100% similarity with a sequence of P. pachysandricola from the United States (HQ897807). Isolate KACC46110 was used in pathogenicity tests. Inoculum was prepared by harvesting conidia from 2-week-old cultures on PDA. Ten young leaves wounded with needles were sprayed with conidial suspensions (~1 × 106 conidia/ml). Ten young leaves that served as the control were treated with sterile distilled water. Plants were covered with plastic bags to maintain a relative humidity of 100% at 25 ± 2°C for 24 h. Typical symptoms of brown spots appeared on the inoculated leaves 4 days after inoculation and were identical to the ones observed in the field. P. pachysandricola was reisolated from 10 symptomatic leaf tissues, confirming Koch's postulates. No symptoms were observed on control plants. Previously, the disease was reported in the United States, Britain, Japan, and the Czech Republic (2,3), but not in Korea. To our knowledge, this is the first report of P. pachysandricola on Pachysandra terminalis in Korea. Since this plant is popular and widely planted in Korea, this disease could cause significant damage to nurseries and the landscape. References: (1) B. O. Dodge. Mycologia 36:532, 1944. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , September 24, 2011. (3) I. Safrankova. Plant Prot. Sci. 43:10, 2007. (4) W. A. Sinclair and H. H. Lyon. Disease of Trees and Shrubs. 2nd ed. Cornell University Press, Ithaca, NY, 2005.

scholarly journals First Report of New Bacterial Leaf Blight of Rice Caused by Pantoea ananatis in Southeast China

Plant Disease ◽  
2021 ◽  
Author(s):  
Lin Yu ◽  
Changdeng Yang ◽  
Zhijuan Ji ◽  
Yuxiang Zeng ◽  
Yan Liang ◽  
...  
Keyword(s):  
Oryza Sativa L ◽  
Sequence Similarity ◽  
Disease Incidence ◽  
Leaf Blight ◽  
Bacterial Leaf Blight ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Pantoea Ananatis ◽  
Southeast China ◽  
First Report

In autumn 2020, leaf blight was observed on rice (Oryza sativa L., variety Zhongzao39, Yongyou9, Yongyou12, Yongyou15, Yongyou18, Yongyou1540, Zhongzheyou8, Jiafengyou2, Xiangliangyou900 and Jiyou351) in the fields of 17 towns in Zhejiang and Jiangxi Provinces, China. The disease incidence was 45%-60%. Initially, water-soaked, linear, light brown lesions emerged in the upper blades of the leaves, and then spread down to leaf margins, which ultimately caused leaf curling and blight during the booting-harvest stage (Fig. S1). The disease symptoms were assumed to be caused by Xanthomonas oryzae pv. oryzae (Xoo), the pathogen of rice bacterial blight. 63 isolates were obtained from the collected diseased leaves as previously described (Hou et al. 2020). All isolates showed circular, smooth-margined, yellow colonies when cultured on peptone sugar agar (PSA) medium for 24h at 28℃. The cells were all gram-negative and rod-shaped with three to six peritrichous flagella; positive for catalase, indole, glucose fermentation and citrate utilization, while negative for oxidase, alkaline, phenylalanine deaminase, urease, and nitrate reductase reactions. 16S rRNA gene sequence analysis from the 6 isolates (FY43, JH31, JH99, TZ20, TZ39 and TZ68) revealed that the amplified fragments shared 98% similarity with Pantoea ananatis type strain LMG 2665T (GenBank JFZU01) (Table S3). To further verify P. ananatis identity of these isolates, fragments of three housekeeping genes including gyrB, leuS and rpoB from the 6 isolates were amplified and sequenced, which showed highest homology to LMG 2665T with a sequence similarity of 95%-100% (Table S3). Primers (Brady et al. 2008) and GenBank accession numbers of gene sequences from the 6 isolates are listed in Table S1 and Table S2. Phylogenetic analysis of gyrB, leuS and rpoB concatenated sequences indicated that the 6 isolates were clustered in a stable branch with P. ananatis (Fig. S2). Based on the above morphological, physiological, biochemical and molecular data, the isolates are identified as P. ananatis. For pathogenicity tests, bacterial suspension at 108 CFU/mL was inoculated into flag leaves of rice (cv. Zhongzao39) at the late booting stage using clipping method. Water was used as a negative control. The clipped leaves displayed water-soaked lesions at 3 to 5 days after inoculation (DAI); then the lesion spread downward and turned light brown. At about 14 DAI, blight was shown with similar symptoms to those samples collected from the rice field of Zhejiang and Jiangxi provinces (Fig. S1). In contrast, the control plants remained healthy and symptomless. The same P. ananatis was re-isolated in the inoculated rice plants, fulfilling Koch’s postulates. In the past decade, P. ananatis has been reported to cause grain discoloration in Hangzhou, China (Yan et al. 2010) and induce leaf blight as a companion of Enterobacter asburiae in Sichuan province, China (Xue et al. 2020). Nevertheless, to the best of our knowledge, this is the first report of P. ananatis as the causative agent of rice leaf blight in southeast China. This study raises the alarm that the emerging rice bacterial leaf blight in southeast China might be caused by a new pathogen P. ananatis, instead of Xoo as traditionally assumed. Further, the differences of occurrence, spread and control between two rice bacterial leaf blight diseases caused by P. ananatis and Xoo, respectively need to be determined in the future.

scholarly journals First Record of Bacterial Blight Caused by Pseudomonas syringae pv. syringae on Pyracantha coccinea and an Amelanchier sp. in Bulgaria

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1251-1251 ◽  
Author(s):  
S. G. Bobev ◽  
S. Baeyen ◽  
J. Van Vaerenbergh ◽  
M. Maes
Keyword(s):  
Pseudomonas Syringae ◽  
Pathogenic Bacteria ◽  
Pcr Amplification ◽  
First Record ◽  
Bacterial Suspension ◽  
Bacterial Strains ◽  
First Occurrence ◽  
Symptomatic Tissue ◽  
And Control ◽  
Pyracantha Coccinea

During the spring and summer months of 2004 and 2005, sporadic damage on individual shrubs of Pyracantha coccinea and an Amelanchier sp. were observed at two locations in the region of Plovdiv, Bulgaria. Symptoms initially were expressed as blossom blight and subsequently expanded to the shoots and branches, forming cankers on the supplying wood. In both years, a fluorescent gram-negative bacterium was isolated from diseased tissues onto King's B medium. The bacterial strains were levan positive and oxidase and arginine dihydrolase negative. They were able to induce a typical hypersensitive response on tobacco plants (cv. Samsun), but failed to rot potato slices. Pathogenicity of the strains was confirmed by puncture-inoculating detached shoots from both hosts and immature cherry and pear fruits with a bacterial suspension (108 CFU/ml, 50 μl per wound, and 3 replicates). Controls were punctured with sterile water. The inoculated plant material was maintained at room temperature (22 to 25°C) in plastic pots and covered with polyethylene bags for the first 48 h after inoculation. The inoculated and control subjects were kept under the same conditions as before inoculation. Except for the controls, slowly expanding but well defined necrotic lesions around the inoculation points were observed within the next 5 to 7 days. Bacteria reisolated from symptomatic tissue were identical to the initial cultures. On the basis of the symptoms and results from all laboratory tests, the bacterium was considered to be Pseudomonas syringae pv. syringae (1). PCR amplification of the 752-bp syrB fragment (2) confirmed the identification. To our knowledge, this is the first occurrence of P. syringae pv. syringae on Pyracantha coccinea and an Amelanchier sp. in Bulgaria, and most probably, this pathogen will play a more significant role within the rosaceous group because of a rising number of the cultivated ornamental species. References: (1) N. W. Schaad et al., eds. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) K. N. Sorensen et al. Appl. Environ. Microbiol. 64:226, 1998.

scholarly journals First Report of Pectobacterium carotovorum subsp. carotovorum Causing Soft Rot of Orostachys japonica in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 989-989 ◽  
Author(s):  
W. Cheon ◽  
Y. H. Jeon
Keyword(s):  
16S Rrna ◽  
Pathogenic Bacteria ◽  
Sequence Similarity ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Pectobacterium Carotovorum ◽  
First Report ◽  
Biolog System ◽  
Carotovorum Subsp ◽  
Physiological Tests

Orostachys japonica (Maxim) A. Berger is an important traditional medicine in Korea. The extract of this plant has antioxidant activity and suppresses cancer cell proliferation (1). From summer through fall of 2012 and 2013, a high incidence (~10% to 30%) of disease outbreaks of all plants characterized by water-soaked lesions and soft rot with a stinky odor was observed in cultivated O. japonica around Uljin (36°59′35.04″N, 126°24′1.51″E), Korea. Water-soaked lesions were first observed on the stem base of plants. Subsequently, the plants collapsed, although the upper portion remained asymptomatic. Thereafter, the lesions expanded rapidly over the entire plant. To isolate potential pathogens from infected leaves, small sections (5 to 10 mm2) were excised from the margins of lesions. Ten bacteria were isolated from ten symptomatic plants. Three representative isolates from different symptomatic plants were used for identification and pathogenicity tests. Isolated bacteria were gram negative, pectolytic on crystal violet pectate agar, nonfluorescent on King's medium B, and elicited a hypersensitive response in tobacco plants. All isolates caused soft rot of potato tubers. These isolates also differed from isolates of Erwinia chrysanthemi (Ech) that they were insensitive to erythromycin and did not produce phosphatase. These isolates differed from known strains of E. carotovora subsp. atroseptica in that they did not produce reducing substances from sucrose (2). Use of the Biolog GN microplate and the Release 4.0 system identified the isolate as Pectobacterium carotovorum subsp. carotovorum with 81.2% similarity. The 16S rRNA of the isolated bacteria was amplified by PCR and sequenced as described by Weisburg et al. (3). A BLAST analysis for sequence similarity of the 16S rRNA region revealed 99% similarity with nucleotide sequences for P. carotovorum subsp. carotovorum isolates (KC790305, KC790280, JF926758, JX196705, and AB680074). The pathogenicity of three bacterial isolates was examined on three 2-year-old O. japonica plants by adding 50 μl of a bacterial suspension containing 108 CFU/ml when wounding the leaves with sterile needles. Ten control plants were inoculated with sterilized water. After inoculation, plants were maintained in a growth chamber at 25°C with relative humidity ranging from 80 to 90%. After 2 to 3 days, tissue discoloration, water-soaked lesions, and soft rot developed around the inoculation point. Severe symptoms of soft rot and darkening developed on leaves of inoculated plants within 3 to 5 days after inoculation. All controls remained healthy during these experiments. The bacterial strains re-isolated from the parts of the leaf showing the symptoms and identified as P. carotovorum subsp. carotovorum on the basis of the biochemical and physiological tests, as well as Biolog system. The results obtained for pathogenicity, Biolog analysis, and molecular data corresponded with those for P. carotovorum subsp. carotovorum. To our knowledge, this is the first report of the presence of P. carotovorum on O. japonica in Korea. References: (1) C.-H. Kim et al. Kor. J. Med. Crop Sci. 11:31, 2003. (2) N. W. Schaad et al. Erwinia Soft Rot Group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al. eds. American Phytopathological Society, St. Paul. MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Strawberry Crown Rot Caused by Xanthomonas fragariae in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Zhiwei Song ◽  
Chen Yang ◽  
Rong Zeng ◽  
Shi-gang Gao ◽  
Wei Cheng ◽  
...  
Keyword(s):  
16S Rrna ◽  
Crown Rot ◽  
Universal Primers ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Species Identity ◽  
Specific Primers ◽  
16S Rrna Sequence ◽  
First Report ◽  
Xanthomonas Fragariae

Strawberry (Fragaria × ananassa Duch.) is a kind of fruit with great economic importance and widely cultivated in the world. From 2019 to 2020, a serious crown rot disease was sporadically observed in several strawberry cultivars including ‘Zhang Ji’, ‘Hong Yan’ and ‘Yue Xiu’ in Shanghai, China. Initially, water-soaked rot appeared in inner tissue of strawberry crown, then progressed into browning and hollowing symptoms accompanied with yellow discolorations of young leaves. To isolate and identify the causal agent, small pieces of tissue taken from ten diseased crowns were sterilized by 70% alcohol. The cut-up pieces were macerated and serially diluted. The dilutions were placed on nutrient agar (NA) medium. After incubation at 25°C for 4-5 days, the yellow bacterial colonies were tiny and were streaked on NA plate for purification. The colonies were yellow, mucoid, smooth-margined, and five independent representative colonies were used for further confirmation. To confirm the species identity of the bacterial, genomic DNA was extracted from the five representative isolates, and 16S rRNA gene was amplified and sequenced using universal primers 27F/1492R. The 16S rRNA sequence was deposited in GenBank (MW725235) and showed 99% nucleotide similarity with Xanthomonas fragariae strain LMG 708 (NR_026318). The isolate’s identity was further confirmed by X. fragariae-specific primers XF9/XF12 (Roberts et al. 1996). All five isolates could be detected by XF9/XF12 primer. To confirm Koch’s postulates, five healthy strawberry plants were placed in 1000 ml glass beakers by submerging the cutting wound in 50 ml the bacterial suspension of 108 CFU/ml. Five additional strawberry plants treated with sterilized water served as a control. The beakers containing inoculated plants were sealed with plastic film at 25°C. Water-soaked rot appeared on internal tissue of crown similar to those observed in the field within 10-12 days after inoculation, while the control samples remained healthy. The bacteria were re-isolated from rot of inoculated crowns, and confirmed by X. fragariae-specific primers XF9/XF12. X. fragariae has been reported to cause angular leaf spot on strawberry in China (Wang et al. 2017; Wu et al., 2020). It’s also found that X. fragariae could systematically infect crown tissue (Milholland et al. 1996; Mahuku and Goodwin, 1997). To our knowledge, this is the first report of X. fragariae causing strawberry crown rot in China. This report increased our understanding of X. fragariae, and showed that the spread of this disease might seriously threaten the development of strawberry industry in the future

Sign in / Sign up

Export Citation Format

Share Document