A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) grapes were collected from different locations in Mississippi (MS) and the Great Smoky Mountains National Park (GSMNP) and were analyzed for the presence of dsRNAs. A muscadine sample of cv. Burgaw (MS-07) from an experimental field in southern MS and a sample of summer grape from GSMNP (GSM-1) contained similar patterns of multiple dsRNA bands reminiscent of closterovirus infections. These dsRNAs were reverse transcribed and subjected to PCR with taxon-specific degenerate primers targeting HSP70h gene of closterovirids as described (5). DNA bands of ~600 bp, amplified from both samples, were cloned and sequenced. Pairwise comparisons showed that two viruses share 75% common nucleotides (nt) and 82% amino acids (aa) in the genome portion sequenced. Comparisons with available sequences in NCBI/GenBank revealed that these viruses are distinct isolates of Grapevine leafroll-associated virus 2 (GLRaV-2). GLRaV-2 is known to occur as divergent molecular variants characterized by different pathological effects on specific indicators ranging from leafroll to graft incompatibility (2). The GSM-1 isolate was most closely related to Red Globe isolate of GLRaV-2 (GLRaV-2RG; AF314061), reported to induce graft incompatibility (1), with 87% identical nt (95% aa). However, isolate MS-07 was most closely related (96% nt and 97% aa identity) to leafroll-inducing isolate 93/955 (GLRaV-2 93/955; NC_007448.1) (3). Virus-specific DIG labeled probe produced strong hybridization signals with nucleic acids extracted from MS07 and GSM-1 and blotted onto a positively charged membrane, thus confirming GLRaV-2 infections. No signal could be observed in negative controls. Finally, a set of GLRaV-2 specific primers (LR-2F: 5′TCGGCGTACATCCCAACTTAC3′ and LR-2R: 5′CTGAGTGAAACGCACTGATC3′), designed to amplify a 422-bp-long PCR product, was applied in one-step RT-PCR tests performed on total nucleic acid extracts from additional 65 samples (60 muscadines and five summer grapes). GLRaV-2 was found in an additional four samples of muscadines (cvs. Burgaw and Hunt and two samples of an unknown cultivar) collected in MS and in one sample of summer grape collected 200 m away from the original source in GSMNP. As further ascertained, all GLRaV-2 isolates from muscadines belonged to “93/955 subgroup,” whereas the additional isolate from summer grape shared 98% identical nt with the isolate GSM-1. No specific symptoms could be associated with the presence of GLRaV-2 in summer grapes or muscadines. This is the first report of GLRaV-2 in muscadines and summer grapes in the United States. Furthermore, the occurrence of GLRaV-2 in summer grapes in a natural ecosystem and in muscadines in Mississippi where there is no sizable V. vinifera industry provides important clues on ecology and possible origin of this virus. References: (1) R. Alkowni et al. Virus Genes 43:102, 2011. (2) N. Bertazzon et al. Eur. J. Plant Pathol. 127:185, 2010. (3) B. Meng et al. Virus Genes 31:31, 2005. (4) S. Sabanadzovic et al. Virology 394:1, 2009. (5) T. Tian et al. Phytopathology 86:1167, 1996.
First Report of Grapevine virus B Infecting Muscadine (Vitis rotundifolia) in the United States
