First Report of Grapevine leafroll-associated virus 2 Infecting Muscadine (Vitis rotundifolia) and Summer Grape (Vitis aestivalis) in the United States

A study, designed to gain some knowledge of viruses infecting native grapes in the southeastern United States, presently limited to a single paper (4), was initiated in spring of 2012. In the first phase of this investigation, 28 samples of muscadine (Vitis rotundifolia) and summer (V. aestivalis) grapes were collected from different locations in Mississippi (MS) and the Great Smoky Mountains National Park (GSMNP) and were analyzed for the presence of dsRNAs. A muscadine sample of cv. Burgaw (MS-07) from an experimental field in southern MS and a sample of summer grape from GSMNP (GSM-1) contained similar patterns of multiple dsRNA bands reminiscent of closterovirus infections. These dsRNAs were reverse transcribed and subjected to PCR with taxon-specific degenerate primers targeting HSP70h gene of closterovirids as described (5). DNA bands of ~600 bp, amplified from both samples, were cloned and sequenced. Pairwise comparisons showed that two viruses share 75% common nucleotides (nt) and 82% amino acids (aa) in the genome portion sequenced. Comparisons with available sequences in NCBI/GenBank revealed that these viruses are distinct isolates of Grapevine leafroll-associated virus 2 (GLRaV-2). GLRaV-2 is known to occur as divergent molecular variants characterized by different pathological effects on specific indicators ranging from leafroll to graft incompatibility (2). The GSM-1 isolate was most closely related to Red Globe isolate of GLRaV-2 (GLRaV-2RG; AF314061), reported to induce graft incompatibility (1), with 87% identical nt (95% aa). However, isolate MS-07 was most closely related (96% nt and 97% aa identity) to leafroll-inducing isolate 93/955 (GLRaV-2 93/955; NC_007448.1) (3). Virus-specific DIG labeled probe produced strong hybridization signals with nucleic acids extracted from MS07 and GSM-1 and blotted onto a positively charged membrane, thus confirming GLRaV-2 infections. No signal could be observed in negative controls. Finally, a set of GLRaV-2 specific primers (LR-2F: 5′TCGGCGTACATCCCAACTTAC3′ and LR-2R: 5′CTGAGTGAAACGCACTGATC3′), designed to amplify a 422-bp-long PCR product, was applied in one-step RT-PCR tests performed on total nucleic acid extracts from additional 65 samples (60 muscadines and five summer grapes). GLRaV-2 was found in an additional four samples of muscadines (cvs. Burgaw and Hunt and two samples of an unknown cultivar) collected in MS and in one sample of summer grape collected 200 m away from the original source in GSMNP. As further ascertained, all GLRaV-2 isolates from muscadines belonged to “93/955 subgroup,” whereas the additional isolate from summer grape shared 98% identical nt with the isolate GSM-1. No specific symptoms could be associated with the presence of GLRaV-2 in summer grapes or muscadines. This is the first report of GLRaV-2 in muscadines and summer grapes in the United States. Furthermore, the occurrence of GLRaV-2 in summer grapes in a natural ecosystem and in muscadines in Mississippi where there is no sizable V. vinifera industry provides important clues on ecology and possible origin of this virus. References: (1) R. Alkowni et al. Virus Genes 43:102, 2011. (2) N. Bertazzon et al. Eur. J. Plant Pathol. 127:185, 2010. (3) B. Meng et al. Virus Genes 31:31, 2005. (4) S. Sabanadzovic et al. Virology 394:1, 2009. (5) T. Tian et al. Phytopathology 86:1167, 1996.

Download Full-text

First Report of Grapevine virus B Infecting Muscadine (Vitis rotundifolia) in the United States

Plant Disease ◽

10.1094/pdis-09-15-1002-pdn ◽

2016 ◽

Vol 100 (4) ◽

pp. 865-865 ◽

Cited By ~ 2

Author(s):

S. Sabanadzovic ◽

N. Aboughanem-Sabanadzovic

Keyword(s):

United States ◽

The United States ◽

Grapevine Virus ◽

First Report ◽

Vitis Rotundifolia ◽

Grapevine Virus B

Download Full-text

First Report of Alternanthera mosaic virus Infection in Angelonia in the United States

Plant Disease ◽

10.1094/pdis-92-10-1473b ◽

2008 ◽

Vol 92 (10) ◽

pp. 1473-1473 ◽

Cited By ~ 7

Author(s):

B. E. Lockhart ◽

M. L. Daughtrey

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Mosaic Virus ◽

Genomic Sequence ◽

Nutrient Deficiency ◽

Leaf Tissue ◽

The United States ◽

Nucleotide Sequence Analysis ◽

Degenerate Primers ◽

First Report

Stunting, chlorosis, and light yellow mottling resembling symptoms of nutrient deficiency were observed in angelonia (Angelonia angustifolia) in commercial production in New York. Numerous, filamentous particles 520 to 540 nm long and spherical virus particles 30 nm in diameter were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts of symptomatic Angelonia leaf tissue. Two viruses, the filamentous potexvirus Alternanthera mosaic virus (AltMV) and the spherical carmovirus Angelonia flower break virus (AnFBV) were subsequently identified on the basis of nucleotide sequence analysis of amplicons generated by reverse transcription (RT)-PCR using total RNA isolated from infected leaf tissue. A 584-bp portion of the replicase-encoding region of the AltMV genome was obtained with the degenerate primers Potex 2RC (5′-AGC ATR GNN SCR TCY TG-3′) and Potex 5 (5′-CAY CAR CAR GCM AAR GAT GA-3′) (3). Forward (AnFBV CP 1F-5′-AGC CTG GCA ATC TGC GTA CTG ATA-3′) and reverse (AnFBV CP 1R-5′-AAT ACC GCC CTC CTG TTT GGA AGT-3′) primers based on the published AnFBV genomic sequence (GenBank Accession No. NC_007733) were used to amplify a portion of the viral coat protein (CP) gene. The nucleotide sequence of the amplicon generated using the potexvirus-specific primers (GenBank Accession No. EU679362) was 99% identical to the published AltMV (GenBank Accession No. NC_007731) sequence and the nucleotide sequence of the amplicon obtained using the AnFBV CP primers was 99% identical to the published AnFBV genomic sequence (GenBank Accession No. EU679363). AnFBV occurs widely in angelonia (1) and AltMV has been identified in phlox (2). These data confirm the presence of AltMV and AnFBV in diseased angelonia plants showing stunting and nutrient deficiency-like symptoms and substantiates, to our knowledge, this first report of AltMV in angelonia in the United States. References: (1) S. Adkins et al. Phytopathology 96:460, 2006. (2) J. Hammond et al. Arch. Virol. 151:477, 2006. (3) R. A. A. van der Vlugt and M. Berendeson. Eur. J. Plant Pathol. 108:367, 2002.

Download Full-text

First Report of Cucumber mosaic virus in Anemone sp. in the United States

Plant Disease ◽

10.1094/pdis-93-4-0431b ◽

2009 ◽

Vol 93 (4) ◽

pp. 431-431 ◽

Cited By ~ 1

Author(s):

I. E. Tzanetakis

Keyword(s):

United States ◽

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Protein A ◽

The United States ◽

University Of Arkansas ◽

Degenerate Primers ◽

First Report ◽

Complete Coat Protein ◽

The University

In the spring of 2008, more than a dozen, aphid-infested, anemone plants (Anemone sp.) grown at the campus of the University of Arkansas in Fayetteville showed stunting and mosaic, whereas only two were asymptomatic. Leaf homogenates from four symptomatic plants were inoculated onto Nicotiana benthamiana that became stunted and developed severe mosaic approximately 7 days postinoculation, whereas buffer-inoculated plants remained asymptomatic. Double-stranded RNA (dsRNA) extraction (4) from symptomatic anemone revealed the presence of four predominant bands of approximately 3.2, 2.9, 2.2, and 0.9 kbp, a pattern indicative of cucumovirus infection. Cucumber mosaic virus (CMV) is the only cucumovirus reported in anemone in Europe (2) and Israel (3), and for this reason, anemone and N. benthamiana plants were tested by Protein A ELISA with antisera against CMV developed by H. A. Scott. ELISA verified the presence of CMV in symptomatic anemone and inoculated N. benthamiana, while asymptomatic plants were free of the virus. Using cucumovirus degenerate primers, essentially as described by Choi et al. (1), a region of approximately 940 bases that includes the complete coat protein gene of the virus was amplified from symptomatic anemone and N. benthamiana but not asymptomatic plants of either species. This anemone isolate (GenBank Accession No. FJ375723) belongs to the IA subgroup of CMV because it shares 99% nucleotide and 100% amino acid sequence identities with the Fny isolates of the virus. To my knowledge, this is the first report of CMV infecting anemone in the United States and an important discovery for the ornamental industry since anemone is commonly grown together with several ornamental hosts of CMV in nursery and garden settings. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) M. Hollings. Ann. Appl. Biol. 45:44, 1957 (3) G. Loebenstein. Acta Hortic. 722:31, 2006 (4) I. E. Tzanetakis and R. R. Martin, J. Virol. Methods 149:167, 2008.

Download Full-text

First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Plant Disease ◽

10.1094/pdis-92-4-0648a ◽

2008 ◽

Vol 92 (4) ◽

pp. 648-648 ◽

Cited By ~ 3

Author(s):

R. L. Jordan ◽

M. A. Guaragna ◽

T. Van Buren ◽

M. L. Putnam

Keyword(s):

United States ◽

Amino Acid ◽

Mosaic Virus ◽

The United States ◽

Cdna Clones ◽

Gene Products ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

First Report

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

Download Full-text

First Report of Pathogenicity of Fusarium sporotrichioides and Fusarium acuminatum on Sunflowers in the United States

Plant Health Progress ◽

10.1094/php-2010-0915-02-br ◽

2010 ◽

Vol 11 (1) ◽

pp. 42 ◽

Cited By ~ 4

Author(s):

F. Mathew ◽

B. Kirkeide ◽

T. Gulya ◽

S. Markell

Keyword(s):

United States ◽

Helianthus Annuus ◽

The United States ◽

Fusarium Sporotrichioides ◽

Charcoal Rot ◽

Koch’S Postulates ◽

First Report ◽

Fusarium Acuminatum ◽

Helianthus Annuus L ◽

Koch's Postulates

Widespread infection of charcoal rot was observed in a commercial sunflower field in Minnesota in September 2009. Based on morphology, isolates were identified as F. sporotrichioides and F. acuminatum. Koch's postulates demonstrated pathogencity of both species. To our knowledge, this is the first report of F. sporotrichoides and F. acuminatum causing disease on Helianthus annuus L. in the United States. Accepted for publication 23 August 2010. Published 15 September 2010.

Download Full-text

First Report of Wisteria vein mosaic virus in Wisteria sinensis in the United States of America

Plant Health Progress ◽

10.1094/php-2008-0818-01-br ◽

2008 ◽

Vol 9 (1) ◽

pp. 42 ◽

Cited By ~ 1

Author(s):

Rayapati A. Naidu ◽

Gandhi Karthikeyan

Keyword(s):

United States ◽

Mosaic Virus ◽

United States Of America ◽

The United States ◽

Home Gardens ◽

First Report ◽

Woody Perennial ◽

Wisteria Sinensis ◽

First Time ◽

Wisteria Vein Mosaic Virus

The ornamental Chinese wisteria (Wisteria sinensis) is a woody perennial grown for its flowering habit in home gardens and landscape settings. In this brief, the occurrence of Wisteria vein mosaic virus (WVMV) was reported for the first time in Chinese wisteria in the United States of America. Accepted for publication 18 June 2008. Published 18 August 2008.

Download Full-text

Expansion of Groundnut ringspot virus Host and Geographic Ranges in Solanaceous Vegetables in Peninsular Florida

Plant Health Progress ◽

10.1094/php-2011-0725-01-br ◽

2011 ◽

Vol 12 (1) ◽

pp. 34 ◽

Cited By ~ 6

Author(s):

Craig G. Webster ◽

William W. Turechek ◽

H. Charles Mellinger ◽

Galen Frantz ◽

Nancy Roe ◽

...

Keyword(s):

United States ◽

The United States ◽

Vegetable Production ◽

Viral Pathogen ◽

Geographic Ranges ◽

First Report ◽

Geographic Spread ◽

Wide Range ◽

Production Areas ◽

Solanaceous Plants

To the best of our knowledge, this is the first report of GRSV infecting tomatillo and eggplant, and it is the first report of GRSV infecting pepper in the United States. This first identification of GRSV-infected crop plants in commercial fields in Palm Beach and Manatee Counties demonstrates the continuing geographic spread of the virus into additional vegetable production areas of Florida. This information indicates that a wide range of solanaceous plants is likely to be infected by this emerging viral pathogen in Florida and beyond. Accepted for publication 27 June 2011. Published 25 July 2011.

Download Full-text

First Report of Colletotrichum queenslandicum on Persian Lime Causing Leaf Anthracnose in the United States

Plant Disease ◽

10.1094/pdis-09-17-1382-pdn ◽

2018 ◽

Vol 102 (3) ◽

pp. 677 ◽

Cited By ~ 1

Author(s):

M. Kunta ◽

J.-W. Park ◽

P. Vedasharan ◽

J. V. da Graça ◽

M. D. Terry

Keyword(s):

United States ◽

The United States ◽

First Report

Download Full-text

Fungicide Sensitivity of Pythium spp. Associated with Cavity Spot of Carrot in California and Michigan

Plant Disease ◽

10.1094/pdis-07-11-0562 ◽

2012 ◽

Vol 96 (3) ◽

pp. 384-388 ◽

Cited By ~ 7

Author(s):

Xiao Hong Lu ◽

R. Michael Davis ◽

S. Livingston ◽

J. Nunez ◽

Jianjun J. Hao

Keyword(s):

United States ◽

Growth Inhibition ◽

Active Ingredient ◽

Mycelial Growth ◽

The United States ◽

Fungicide Sensitivity ◽

First Report ◽

Cavity Spot ◽

Pythium Violae

The identity of 172 isolates of Pythium spp. from cavity spot lesions on carrot produced in California and Michigan was determined, and their sensitivity to three fungicides was examined. Pythium violae accounted for 85% of California isolates, with P. irregulare, P. dissotocum (the first report as a carrot pathogen in the United States), P. ultimum, and P. sulcatum making the balance. P. sulcatum, P. sylvaticum, and P. intermedium were the most commonly recovered (85%) species in Michigan; others from Michigan included P. intermedium, P. irregulare, and an unclassified strain, M2-05. On fungicide-amended media, 93% of isolates were sensitive to mefenoxam (inhibition of mycelial growth was >60% at 10 μg active ingredient [a.i.]/ml); however, two of five isolates of P. irregulare from California were highly resistant (≤60% inhibition at 100 μg a.i./ml); about half of the isolates of P. intermedium and P. sylvaticum and a single isolate of P. violae were highly or intermediately resistant to mefenoxam (>60% inhibition at 100 μg a.i./ml, or ≤60% inhibition at 10 μg a.i./ml). P. dissotocum, P. irregulare, P. sulcatum, M2-05, and three of seven isolates of P. intermedium were insensitive to fluopicolide (effective concentrations for 50% growth inhibition [EC50] were >50 μg a.i./ml), while P. sylvaticum, P. ultimum, P. violae, and some isolates in P. intermedium were sensitive (EC50 < 1 μg a.i./ml). All isolates were sensitive to zoxamide (EC50 < 1 μg a.i./ml). Sensitivity baselines of P. violae to zoxamide and fluopicolide were established.

Download Full-text