First Report of Tomato chlorotic spot virus on Annual Vinca (Catharanthus roseus) in the United States

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

Download Full-text

First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽

10.1094/pd-91-0113b ◽

2007 ◽

Vol 91 (1) ◽

pp. 113-113 ◽

Cited By ~ 5

Author(s):

H. F. Schwartz ◽

K. Otto ◽

H. R. Pappu

Keyword(s):

United States ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Allium Porrum ◽

Rt Pcr ◽

Spot Virus ◽

Disease Symptoms ◽

First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

Download Full-text

First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽

10.1094/pdis-91-5-0633b ◽

2007 ◽

Vol 91 (5) ◽

pp. 633-633 ◽

Cited By ~ 8

Author(s):

H.-Y. Liu ◽

J. L. Sears

Keyword(s):

United States ◽

The United States ◽

Rt Pcr ◽

Spot Virus ◽

Chenopodium Amaranticolor ◽

Tomato Plants ◽

First Report ◽

Chenopodium Murale ◽

Tomato Field ◽

Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

Download Full-text

First Report of Natural Infection of Garlic with Iris yellow spot virus in the United States

Plant Disease ◽

10.1094/pdis-93-8-0839a ◽

2009 ◽

Vol 93 (8) ◽

pp. 839-839 ◽

Cited By ~ 5

Author(s):

S. Bag ◽

P. Rogers ◽

R. Watson ◽

H. R. Pappu

Keyword(s):

United States ◽

Natural Infection ◽

Sandwich Elisa ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

Sequence Comparisons ◽

First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to onion bulb and seed production in several onion-growing regions of the United States (1,3). While garlic (Allium sativum) was reported to be infected with IYSV in Réunion Island (4), there have been no confirmed reports of natural infection of garlic in the United States. Garlic plants showing near-diamond-shaped lesions were found in August of 2008 in Marion County, Oregon. The 0.4046-ha (1-acre) field plot consisted of various true-seeded garlic varieties and was adjacent to three onion fields that showed IYSV symptoms. Symptoms were observed on 5% of the garlic plants with most of the symptomatic plants displaying small and diffuse straw-colored spots. Seven of these symptomatic plants were selected for testing. Of these, two showed characteristic diamond-shaped, elongated, straw-colored lesions on garlic scapes. However, the lesions were more diffuse with less-defined edges compared with the characteristic diamond-shaped lesions that are often associated with IYSV infection (1). All symptomatic plants were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). To verify IYSV infection, total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV by reverse transcription (RT)-PCR with primers 5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTTAACAAGCAC-3′, which flank the nucleocapsid (N) gene coded by the small RNA of IYSV (2). An approximate 1.1-kb amplicon was obtained from all symptomatic plants and cloned and sequenced. Nucleotide sequence comparisons using BLAST showed that a consensus of three clones derived from the amplicon from garlic (No. FJ514257) was 85 to 99% identical with IYSV sequences available in GenBank (Nos. AF001387, AB180918, and AB286063), confirming the identity of IYSV. To our knowledge, this is the first report of natural infection of IYSV infection of garlic in the United States. Additional surveys and testing are needed to obtain a better understanding of IYSV incidence in garlic to evaluate its impact on garlic production. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Download Full-text

Emergence of Groundnut ringspot virus and Tomato chlorotic spot virus in Vegetables in Florida and the Southeastern United States

Phytopathology ◽

10.1094/phyto-06-14-0172-r ◽

2015 ◽

Vol 105 (3) ◽

pp. 388-398 ◽

Cited By ~ 55

Author(s):

Craig G. Webster ◽

Galen Frantz ◽

Stuart R. Reitz ◽

Joseph E. Funderburk ◽

H. Charles Mellinger ◽

...

Keyword(s):

United States ◽

New York ◽

South Carolina ◽

Southeastern United States ◽

The United States ◽

South Florida ◽

Ringspot Virus ◽

Spot Virus ◽

Genomic Rnas ◽

Chlorotic Spot

Groundnut ringspot virus (GRSV) and Tomato chlorotic spot virus (TCSV) are two emerging tospoviruses in Florida. In a survey of the southeastern United States, GRSV and TCSV were frequently detected in solanaceous crops and weeds with tospovirus-like symptoms in south Florida, and occurred sympatrically with Tomato spotted wilt virus (TSWV) in tomato and pepper in south Florida. TSWV was the only tospovirus detected in other survey locations, with the exceptions of GRSV from tomato (Solanum lycopersicum) in South Carolina and New York, both of which are first reports. Impatiens (Impatiens walleriana) and lettuce (Lactuca sativa) were the only non-solanaceous GRSV and/or TCSV hosts identified in experimental host range studies. Little genetic diversity was observed in GRSV and TCSV sequences, likely due to the recent introductions of both viruses. All GRSV isolates characterized were reassortants with the TCSV M RNA. In laboratory transmission studies, Frankliniella schultzei was a more efficient vector of GRSV than F. occidentalis. TCSV was acquired more efficiently than GRSV by F. occidentalis but upon acquisition, transmission frequencies were similar. Further spread of GRSV and TCSV in the United States is possible and detection of mixed infections highlights the opportunity for additional reassortment of tospovirus genomic RNAs.

Download Full-text

First Report of Iris yellow spot virus Infecting Green Onion (Allium fistulosum) in the United States

Plant Disease ◽

10.1094/pdis-05-16-0599-pdn ◽

2016 ◽

Vol 100 (12) ◽

pp. 2539-2539 ◽

Cited By ~ 2

Author(s):

A. Tabassum ◽

S. Reitz ◽

P. Rogers ◽

H. R. Pappu

Keyword(s):

United States ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Allium Fistulosum ◽

Spot Virus ◽

First Report

Download Full-text

First Report of Pathogenicity of Fusarium sporotrichioides and Fusarium acuminatum on Sunflowers in the United States

Plant Health Progress ◽

10.1094/php-2010-0915-02-br ◽

2010 ◽

Vol 11 (1) ◽

pp. 42 ◽

Cited By ~ 4

Author(s):

F. Mathew ◽

B. Kirkeide ◽

T. Gulya ◽

S. Markell

Keyword(s):

United States ◽

Helianthus Annuus ◽

The United States ◽

Fusarium Sporotrichioides ◽

Charcoal Rot ◽

Koch’S Postulates ◽

First Report ◽

Fusarium Acuminatum ◽

Helianthus Annuus L ◽

Koch's Postulates

Widespread infection of charcoal rot was observed in a commercial sunflower field in Minnesota in September 2009. Based on morphology, isolates were identified as F. sporotrichioides and F. acuminatum. Koch's postulates demonstrated pathogencity of both species. To our knowledge, this is the first report of F. sporotrichoides and F. acuminatum causing disease on Helianthus annuus L. in the United States. Accepted for publication 23 August 2010. Published 15 September 2010.

Download Full-text

First Report of Wisteria vein mosaic virus in Wisteria sinensis in the United States of America

Plant Health Progress ◽

10.1094/php-2008-0818-01-br ◽

2008 ◽

Vol 9 (1) ◽

pp. 42 ◽

Cited By ~ 1

Author(s):

Rayapati A. Naidu ◽

Gandhi Karthikeyan

Keyword(s):

United States ◽

Mosaic Virus ◽

United States Of America ◽

The United States ◽

Home Gardens ◽

First Report ◽

Woody Perennial ◽

Wisteria Sinensis ◽

First Time ◽

Wisteria Vein Mosaic Virus

The ornamental Chinese wisteria (Wisteria sinensis) is a woody perennial grown for its flowering habit in home gardens and landscape settings. In this brief, the occurrence of Wisteria vein mosaic virus (WVMV) was reported for the first time in Chinese wisteria in the United States of America. Accepted for publication 18 June 2008. Published 18 August 2008.

Download Full-text