First Report of Powdery Mildew Caused by Erysiphe heraclei on Curled Dock (Rumex crispus) in South Korea

Curled dock (Rumex crispus L.) is a perennial flowering plant in family Polygonaceae, native to Europe and western Asia. Curled dock is a widespread naturalized species throughout the temperate world that has become a serious invasive species as a weed in many areas. In contrast, the plant has been widely used as a folk medicine for treatment of indigestion and dermatoses in Asia countries. The plant roots are known to have an antifungal effect against barley powdery mildew pathogens. In late October 2010 to 2011, plants showing typical symptoms of powdery mildew disease were observed in a river bank area located in Gwangju, South Korea. Symptoms included generally white, superficial mycelia and abundant necrotic black spots showing superficial chasmothecia. Mycelia were ectophytic with lobed appressoria. Conidiophores were cylindrical, straight, or slightly flexuous in foot cells and bore single conidia. The foot cell of the fungus had a greater range of size than Erysiphe polygoni. Conidia and conidiophores were 25.4 to 45.4 (36.5) μm long × 10.5 to 18.6 (15.0) μm wide and 34.7 to 126.0 (91.4) μm long × 8 to 10 (8.7) μm wide, respectively. The teleomorph included spherical to subspherical ascocarps that were (blackish) brown to yellow and formed hyphoid appendages. Appendages were slightly flexuous and 62.0 to 128.1 (71.6) μm wide. Mature chasmothecia were 75.1 to 140.9 (105) μm. The ascocarps contained multiple asci that were saccate, ellipsoidal and papillate in apices, bore 3 to 5 ascospores, and were 59.4 to 66.1 (60.9) μm long × 32.6 to 43.9 (38.3) μm wide. Ascospores were subhyaline, oval to ellipsoid, and 17.9 to 24.8 (21.1) μm long × 10.9 to 15.2 (13.3) μm wide. From extracted genomic DNA, the internal transcribed spacer (ITS) region inclusive of 5.8S and 28S rDNA were amplified with ITS1F (5′-TCCGTAGGTGAACCTGCGG-3′) and LR5F (5′-GCTATCCTGAGGGAAAC-3′), and LROR (5′-ACCCGCTGAACTTAAGC-3′) and LR5F primer sets, respectively. rDNA ITS (JX499184) and 28S (JX888470) homologies of the fungal strain (EML-RCPW1) via NCBI BLASTn search represented 99.7% (618/620) and 100% (667/667) identity values with E. heraclei AB104510 and AB103366, respectively. The identification of the fungus as E. heraclei was based on morphological data combined with the results of sequence analysis. Although there were no 28S sequence data from E. polygoni in GenBank, the phylogenetic tree based on ITS sequence data showed that our strain was differentiated from E. polygoni, forming a separate clade consisting of E. heraclei. So far, 26 records with respect to powdery mildews on curled dock represent those caused by only E. polygoni worldwide (1). E. heraclei has been reported to occur on various herbaceous plants including Angelica spp., Daucus spp., and Torilis japonica, and a woody plant such as Quercus myrsinaefolia in China, Japan, and Korea. To our knowledge, this is the first report of leaf powdery mildew caused by E. heraclei on curled dock in Korea or elsewhere in the world, although the fungus causes powdery mildew on various species of families Polygonaceae and Apiaceae with wide host range (2,3,4). References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , June 22, 2012. (2) D. A. Glawe et al. Online. Plant Health Progress. PHP-2005-0114-01-HN, 2005. (3) M. J. Park et al. New Dis. Rep. 21:14, 2010. (4) G. Rodríguez-Alvarado et al. Plant Dis. 94:483, 2010.

Download Full-text

First Report of Golovinomyces sonchicola Causing Powdery Mildew on Sonchus oleraceus in Mexico

Plant Disease ◽

10.1094/pdis-01-21-0117-pdn ◽

2021 ◽

Author(s):

Hugo Beltrán-Peña ◽

Alma Rosa Solano-Báez ◽

Ruben Felix-Gastelum ◽

Kamila C. Correia ◽

Moises Camacho-Tapia ◽

...

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Morphological Data ◽

Morphological Identification ◽

28S Rrna ◽

Voucher Specimen ◽

First Report ◽

Sonchus Oleraceus ◽

Western Asia ◽

Symptoms And Signs

Sonchus oleraceus, common sow thistle, is native to Europe, Northern Africa, and Western Asia. This plant has become a common weed throughout the world. In Mexico, this weed has become widely naturalized by replacing indigenous plants and invading many agricultural areas. During the spring of 2018 and 2019, common sow thistle plants showing typical symptoms and signs of powdery mildew, were collected from agricultural fields in Ahome, Sinaloa, Mexico. As much as 30% of plants were diseased and 60 to 95% of the foliage was affected. Mycelium was conspicuous and white-gray, and on stems and both surfaces of leaves. Appressoria were nipple-shaped to crenulate. Conidiophores (n= 30) were hyaline, cylindrical, erect, and up to 150 μm long. Foot-cells (n= 30) were distinctly curved, 47 to 75 × 10 to 13 μm, slightly constricted, followed by 1–3 shorter cells and formed conidia in chains. Conidia (n= 100) were ellipsoid to doliiform to subcylindrical, 28 to 37 × 14 to 19 μm, lacked fibrosin bodies, and germinated from the apex. Chasmothecia were not observed. The morphological characters were consistent with those of the anamorphic state of Golovinomyces sonchicola (Braun and Cook 2012, Jakše et al. 2019). A voucher specimen (accession no. FAVF215) was deposited in the Herbarium of the Faculty of Agriculture of El Fuerte Valley at the Autonomous University of Sinaloa (Juan Jose Rios, Sinaloa, Mexico). To confirm the morphological identification, genomic DNA was extracted from mycelium and conidia, and the internal transcribed spacer (ITS) region and part of the 28S gene were amplified by PCR and sequenced. The ITS region of rDNA was amplified using the primers ITS5/ITS4 (White et al. 1990). For amplification of the 28S rRNA partial gene, a nested PCR was performed using the primer sets PM3 (Takamatsu and Kano 2001)/TW14 (Mori et al. 2000) and NL1/TW14 (Mori et al. 2000) for the first and second reactions, respectively. Phylogenetic analyses using the maximum parsimony and maximum likelihood methods (Braun et al. 2019), including ITS and 28S sequences of isolates of Golovinomyces spp. were performed and confirmed the results obtained from the morphological analysis. Isolate FAVF215 grouped in a clade with the other isolates of G. sonchicola. The ITS and 28S sequences were deposited in GenBank under accession numbers MW425872 and MW442972, respectively. Pathogenicity was demonstrated by gently dusting conidia from infected leaves onto leaves of 20 healthy plants and covered with plastic bags for 24 h. Ten non-inoculated plants served as controls. All plants were maintained in a greenhouse at 25 to 35ºC. All inoculated plants developed similar symptoms to those observed in the field from natural infections after 12 days, whereas powdery mildew symptoms and signs were not observed on control plants. The morphology asexual structures of fungus on inoculated plants were identical to those on naturally infected plants, fulfilling Koch’s postulates. Inoculation tests were repeated twice with identical results. Based on the morphological data and phylogenetic analysis, the fungus was identified as G. sonchicola. This fungus has been reported causing powdery mildew on S. oleraceus in Germany, The Netherlands, Slovenia, and The United Kingdom (Farr and Rossman 2021). To the best of our knowledge, this is the first report of G. sonchicola causing powdery mildew on S. oleraceus in Mexico. This powdery mildew pathogen may represent an option for the biological control of common sow thistle.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces cichoracearum on English Daisy (Bellis perennis) in Italy

Plant Disease ◽

10.1094/pdis-92-3-0484a ◽

2008 ◽

Vol 92 (3) ◽

pp. 484-484 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

A. Minuto ◽

M. L. Gullino

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Northern Italy ◽

Flowering Plant ◽

Pathogenicity Test ◽

First Report ◽

Golovinomyces Cichoracearum ◽

Blastn Analysis ◽

Commercial Farms ◽

Voucher Specimens

Bellis perennis (English daisy) is a flowering plant belonging to the Asteraceae and is increasingly grown as a potted plant in Liguria (northern Italy). In February 2007, severe outbreaks of a previously unknown powdery mildew were observed on plants in commercial farms at Albenga (northern Italy). Both surfaces of leaves of affected plants were covered with white mycelia and conidia. As the disease progressed, infected leaves turned yellow. Mycelia and conidia also were observed on stems and flower calyxes. Conidia were hyaline, ellipsoid, borne in chains (as many as three conidia per chain), and measured 27.7 × 16.9 (15.0 to 45.0 × 10.0 to 30.0) μm. Conidiophores measured 114.0 × 12.0 (109.0 to 117.0 × 11.0 to 13.0) μm and showed a foot cell measuring 78.0 × 11.0 (72.0 to 80.0 × 11.0 to 12.0) μm followed by two shorter cells. Fibrosin bodies were absent. Chasmothecia were not observed in the collected samples. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 415 bp obtained showed an E-value of 7e–155 with Golovinomyces cichoracearum (3). The nucleotide sequence has been assigned the GenBank Accession No. AB077627.1 Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy B. perennis plants. Twenty plants were inoculated. Fifteen noninoculated plants served as a control. Plants were maintained in a greenhouse at temperatures ranging from 10 to 30°C. Seven days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. The fungus observed on inoculated plants was morphologically identical to that originally observed. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on B. perennis in Italy. The disease was already reported in other European countries (2). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) U. Braun The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (3) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000.

Download Full-text

First Report of Powdery Mildew Caused by Erysiphe platani on Sycamore (Platanus occidentalis) in South Korea

Plant Disease ◽

10.1094/pdis-10-12-0940-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 841-841

Author(s):

H. B. Lee ◽

H. W. Lee ◽

H. Y. Mun

Keyword(s):

United States ◽

Powdery Mildew ◽

South Korea ◽

Sequence Data ◽

Average Rate ◽

Nationwide Survey ◽

The United States ◽

High Sequence Identity ◽

First Report ◽

Platanus Occidentalis

Platanus occidentalis L. (sycamore) is an important shade tree distributed throughout the Northern Hemisphere and in South Korea. It has been widely used as an ornamental tree, especially in urban regions and by roadsides. The average rate of roadside planting throughout South Korea covers about 5.7% (up to 38% in Seoul), equivalent to 0.36 million trees. In early July 2012, after a rainy spell in summer, an outbreak of powdery mildew on sycamore was first observed on roadside trees in Gwangju, a southern province of South Korea. A more extensive nationwide survey revealed no powdery mildew in northern or central regions of South Korea. The disease has spread rapidly within Gwangju, even though fungicide applications were carried out after the rainy spell. Major symptoms included white, superficial mycelia, grey to brown lesions on the surface of the leaves due to the presence of a hyperparasite (tentatively identified as Ampelomyces sp.), a slight chlorosis, and severe leaf distortion followed by defoliation. Conidiophores were produced singly, straight, and unbranched, with lengths of 35.2 to 315.2 μm (average 170.4 μm). Conidia were ellipsoid or doliiform, ranging in size from 34.9 to 47.4 μm (average 38.2 μm) long × 16.5 to 26.8 μm (average 23.9 μm) wide. Primary conidia had a truncate base and rounded apex; secondary conidia had both a truncate base and apex. The conidial outer surface had a reticulated wrinkling. Cleistothecia (i.e., sexual spore structures) were not found during the survey, which extended from July to October. These characteristics and the host species match those of Microsphaera platani (syn. Erysiphe platani), which was described on P. occidentalis in Washington State (2). Fungal rDNA was amplified using primers ITS1 and LR5F (4) for one sample (EML-PLA1, GenBank JX485651). BLASTn searches of GenBank revealed high sequence identity to E. platani (99.5% to JQ365943 and 99.3% to JQ365940). Recently, Liang et al. (3) reported the first occurrence of powdery mildew by E. platani on P. orientalis in China based only on its morphology. Thus, in this study, author could only use ITS sequence data from the United States and Europe to characterize the isolate. To date, nine records of powdery mildews of Platanus spp. have been reported worldwide: on P. hispanica from Brazil, Japan, Hungary, and Slovakia; P. orientalis from Israel; P. racemosa from the United States; P. × acerifolia from the United Kingdom and Germany; and Platanus sp. from Argentina and Australia (1). Interestingly, the hyperparasite, Ampelomyces sp., was found with E. platani, suggesting that there may be some level of biocontrol in nature. Pathogenicity was confirmed by gently pressing diseased leaves onto six leaves of healthy sycamore plants in the field in September. The treated leaves were sealed in sterilized vinyl pack to maintain humid condition for 2 days. Similar symptoms were observed on the inoculated leaves 10 days after inoculation. Koch's postulates were fulfilled by re-observing the fungal pathogen. To our knowledge, this is the first report of powdery mildew caused by E. platani on sycamore in South Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. http://nt.ars-grin.gov/fungaldatabases/ , 2012. (2) D. A. Glawe. Plant Health Progress, doi:10.1094/PHP-2003-0818-01-HN, 2003. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) T. J White et al., pp. 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., ed. Academic Press, New York, 1990.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America

Plant Disease ◽

10.1094/pdis-94-2-0279b ◽

2010 ◽

Vol 94 (2) ◽

pp. 279-279 ◽

Cited By ~ 1

Author(s):

A. M. Minnis ◽

A. Y. Rossman ◽

D. L. Clement ◽

M. K. Malinoski ◽

K. K. Rane

Keyword(s):

North America ◽

Powdery Mildew ◽

Dna Sequence ◽

Sequence Data ◽

Its Region ◽

Podosphaera Leucotricha ◽

First Report ◽

Pyrus Calleryana ◽

Dna Sequence Data ◽

Callery Pear

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

Download Full-text

First Report of Neoerysiphe sechii Causing Powdery Mildew on Sechium edule in San Luis Potosi, Mexico

Plant Disease ◽

10.1094/pdis-07-21-1432-pdn ◽

2021 ◽

Author(s):

Jorge Cadena-Iñiguez ◽

Gildardo Olguín-Hernández ◽

Moises Camacho-Tapia ◽

Kamila C. Correia ◽

Alma Rosa Solano-Báez ◽

...

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Morphological Data ◽

Pathogenicity Test ◽

Accession Number ◽

First Report ◽

San Luis ◽

Sechium Edule ◽

San Luis Potosi ◽

San Luis Potosí

From 2018 to 2020, powdery mildew-like signs and symptoms were observed on chayote (Sechium edule var. virens levis) in a commercial field located in Santa María del Río, San Luis Potosí, Mexico. Signs appeared as whitish powdery masses on both sides of leaves and stems. Disease incidence was about 30% and signs covered up to 70% of leaf surface. Ten samples were collected and analyzed. Mycelium was amphigenous, persistent, white, in dense patches. Hyphal appressoria were lobed and solitary. Conidiophores (n = 30) were hyaline, erect, straight, and 62 to 101 μm long. Foot cells were cylindrical and straight, followed by 1–3 shorter cells, and forming conidia in short chains. Conidia (n = 100) were hyaline, surface striate, cylindrical-ellipsoid, doliiform or ovoid, 25.7 to 37.6 × 11.9 to 18.4 μm, without fibrosin bodies, and with germ tubes terminal or subterminal. Conidial appressoria were lobed. Chasmothecia were not observed. The morphological characters were consistent with those of the anamorphic state of Neoerysiphe sechii (Gregorio-Cipriano et al. 2020). A voucher specimen was deposited in the Herbarium of the Department of Agricultural Parasitology at the Chapingo Autonomous University under accession number UACH192. To confirm the identification of the fungus, genomic DNA was extracted from conidia and mycelium, and the internal transcribed spacer (ITS) region and part of the 28S gene were amplified by PCR and sequenced. The ITS region of rDNA was amplified using the primers ITS5/ITS4 (White et al. 1990). For amplification of the 28S rRNA partial gene, a nested PCR was performed using the primer sets PM3 (Takamatsu and Kano 2001)/TW14 (Mori et al. 2000) and NL1/TW14 (Mori et al. 2000) for the first and second reactions, respectively. Phylogenetic analyses using the maximum parsimony and maximum likelihood methods, including ITS and 28S sequences of isolates of Neoerysiphe spp. were performed and confirmed the results obtained in the morphological analysis. The isolate UACH192 grouped in a clade with isolates of N. sechii. The ITS + 28S sequence was deposited in GenBank under accession number MZ468642. Pathogenicity was confirmed by gently dusting conidia from infected leaves onto ten leaves of healthy chayote plants. Five non-inoculated leaves served as controls. The plants were maintained in a greenhouse at 25 to 30 ºC, and relative humidity of 60 to 70%. All inoculated leaves developed similar symptoms to the original observation after 8 days, whereas control leaves remained disease free. Microscopic examination of the fungus on inoculated leaves showed that it was morphologically identical to that originally observed. The pathogenicity test was repeated twice with similar results. Based on morphological data and phylogenetic analysis, as well as pathogenicity test, the fungus was identified as N. sechii. This pathogen has been previously reported causing powdery mildew on S. edule and S. mexicanum in Veracruz, Mexico (Gregorio-Cipriano et al. 2020). However, to our knowledge, this is the first report of N. sechii causing powdery mildew on chayote in San Luis Potosí (Central Mexico). This pathogen represents a serious threat to chayote production and disease management strategies should be developed.

Download Full-text

First Report of Powdery Mildew Caused by Oidium hortensiae on Mophead Hydrangea in Korea

Plant Disease ◽

10.1094/pdis-03-12-0300-pdn ◽

2012 ◽

Vol 96 (7) ◽

pp. 1072-1072 ◽

Cited By ~ 3

Author(s):

M. J. Park ◽

S. E. Cho ◽

J. H. Park ◽

S. K. Lee ◽

H. D. Shin

Keyword(s):

Powdery Mildew ◽

Sequence Data ◽

Morphological Characteristics ◽

Signs And Symptoms ◽

Its Region ◽

Polyethylene Film ◽

Width Ratio ◽

First Report ◽

Close Phylogenetic Relationship ◽

Powdery Mildew Disease

Hydrangea macrophylla (Thunb.) Ser., known as mophead hydrangea, is native to Japan and is used as a potted ornamental or is planted for landscaping in gardens worldwide. In May 2011, powdery mildew occurred on potted mophead hydrangea cv. Emerald plants in polyethylene-film-covered greenhouses in Icheon, Korea. Heavily infected plantings were unmarketable, mainly due to purplish red discoloration and crinkling of leaves. Such powdery mildew symptoms on mophead hydrangea in gardens had been often found in Korea since 2001, and the collections (n = 10) were deposited in the Korea University herbarium (KUS). In all cases, there was no trace of chasmothecia formation. Mycelium was effuse on both sides of leaves, young stems, and flower petals. Appressoria were well developed, lobed, and solitary or in opposite pairs. Conidiophores were cylindrical, 70 to 145 × 7.5 to 10 μm, and composed of three to four cells. Foot-cells of conidiophores were straight to sub-straight, cylindric, short, and mostly less than 30 μm long. Conidia produced singly were ellipsoid to oval, 32 to 50 × 14 to 22 μm with a length/width ratio of 1.7 to 2.8, lacked fibrosin bodies, and showed angular/rectangular wrinkling of outer walls. Germ tubes were produced on the perihilar position of conidia. Primary conidia were apically conical, basally rounded to subtruncate, 32 to 42 × 14 to 18 μm, and thus generally smaller than the secondary conidia. The morphological characteristics are consistent with previous descriptions of Oidium hortensiae Jørst. (3,4). To confirm the identification, the complete internal transcribed spacer (ITS) region of rDNA from KUS-F25514 was amplified with primers ITS5 and P3 and directly sequenced. The resulting sequence of 694 bp was deposited in GenBank (Accession No. JQ669944). There was no ITS sequence data known from powdery mildews on Hydrangea. Therefore, this is the first sequence of O. hortensiae submitted to GenBank. Nevertheless, a GenBank BLAST search of this sequence showed >99% similarity with those of Oidium spp. recorded on crassulacean hosts (e.g. GenBank Accession Nos. EU185641 ex Sedum, EU185636 ex Echeveria, and EU185639 ex Dudleya) (2), suggesting their close phylogenetic relationship. Pathogenicity was confirmed through inoculation by gently pressing diseased leaves onto leaves of five healthy potted mophead hydrangea cv. Emerald plants. Five noninoculated plants of the same cultivar served as controls. Plants were maintained in a greenhouse at 22 ± 2°C. Inoculated plants developed signs and symptoms after 6 days, whereas the control plants remained healthy. The fungus present on the inoculated plants was morphologically identical to that originally observed on diseased plants, fulfilling Koch's postulates. Occurrence of powdery mildew disease on mophead hydrangea is circumglobal (1). To our knowledge, this is the first report of powdery mildew disease caused by O. hortensiae on mophead hydrangea in Korea. Powdery mildew infections in Korea pose a serious threat to the continued production of quality potted mophead hydrangea in polyethylene-film-covered greenhouses. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved March 19, 2012, from http://nt.ars-grin.gov/fungaldatabases/ . (2) B. Henricot. Plant Pathol. 57:779, 2008. (3) A. Schmidt and M. Scholler. Mycotaxon 115:287, 2011. (4) S. Tanda. J. Agric. Sci. Tokyo Univ. Agric. 43:253, 1999.

Download Full-text

First Report of Powdery Mildew on Trident Maple Caused by Sawadaea nankinensis in Korea

Plant Disease ◽

10.1094/pdis-93-12-1348c ◽

2009 ◽

Vol 93 (12) ◽

pp. 1348-1348

Author(s):

H. B. Lee ◽

C. J. Kim ◽

H. Y. Mun ◽

J. P. Hong ◽

D. A. Glawe

Keyword(s):

Powdery Mildew ◽

Its Region ◽

Agricultural Science ◽

Morphological Data ◽

First Report ◽

5.8S Rdna ◽

Rdna Sequences ◽

National University ◽

Causal Fungus ◽

Pathogenicity Tests

Trident maple (Acer buergerianum Miq.) is widely grown in Korea as an ornamental tree as well as for the art of bonsai. During 2008 and 2009, a powdery mildew was observed on trident maple plants at the campus of Chonnam National University, Gwangju, Korea. Further surveys revealed the disease to be widespread on this species in other areas including Jeonbuk and Chungnam provinces in Korea. White, superficial mycelia were observed on young shoots and leaves early in spring. Both macroconidia and microconidia were produced beginning in May and conidial production continued through the summer into September and October. Production of chasmothecia was observed starting in September and continued into October. Macroconidia were produced in chains that were sinuate in outline. Individual macroconidia were barrel shaped and 23.4 to 30.0 (26.6) × 15.6 to 21.1 (18.1) μm. Foot cells of macroconidial conidiophores were 26.7 to 110.7 (48) × 7.1 to 11.2 (8.8) μm with one to five following cells. Microconidia were broadly ellipsoidal to subglobose and 8.9 to 12.5 (10.5) × 4.3 to 5.8 (5.1) μm. Chasmothecia typically were formed on adaxial leaf surfaces and 193.2 to 238.1 (216.8) μm in diameter. Appendages bore uncinate to circinate apices and were 176.8 to 267.7 (211.5) × 4.3 to 8.0 (6.2) μm. From extracted genomic DNA, internal transcribed spacer (ITS) region inclusive of 5.8S rDNA was amplified with ITS1F (5′-CTTGGTCATTTAGAGGAAGT-3′) and LR5F (5′-GCTATCCTGAGGGAAAC-3′) primers. The causal fungus was determined to be Sawadaea nankinensis (F.L. Tai) S. Takam. & U. Braun (2) on the basis of morphological data and ITS rDNA sequences. A BLAST search of GenBank with an ITS sequence from this fungus determined that the five sequences exhibiting the highest max score values (1,811 to 2,004) were from S. nankinensis; these sequences produced max ident values from 94% to 99%. In contrast, max score and max ident values from sequences of other Sawadaea spp. were lower, including scores of 1,063 and 98% similarity for S. polyfida var. japonica, 915 and 97% for S. tulasnei, and 913 and 97% for S. bicornis. Pathogenicity tests were conducted on field-grown plants in two replicates. These plants were inoculated with a paintbrush to apply conidia (~5 × 106/ml) collected from powdery-mildew-infected leaves. Inoculated plants developed powdery mildew symptoms within 5 days of inoculation and resembled those observed on naturally infected plants. S. nankinensis (synonym Uncinula nankinensis) was first reported on A. buergerianum from China in 1930 (2). Recently, S. nankinensis (F.L. Tai) S. Takam & U. Braun was reported to occur on A. buergerianum in Japan (3). Until now, three Sawadaea spp. (S. bicornis (Wallr.) Homma, S. negundinis Homma, and S. tulasnei (Fuckel) Homma) have been reported to cause powdery mildew on A. ginnala, but only S. bicornis (= U. circinata Cooke & Peck) has been reported to cause powdery mildew on A. ginnala in Korea (1). However, no Sawadaea sp. previously was reported to cause powdery mildew on A. buergerianum. To our knowledge, this is the first report of powdery mildew on trident maple (A. buergerianum) caused by S. nankinensis in Korea. References: (1) H. D. Shin. Erysiphaceae of Korea. National Institute of Agricultural Science and Technology, 2000. (2) F. L. Tai. Page 1517 in: Sylloge Fungorum Sinicorum. Science Press, Academia Sinica, Peking, 1979. (3) S. Takamatsu et al. Mycoscience 49:161, 2008.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces cichoracearum on Orange Coneflower (Rudbeckia fulgida) in Italy

Plant Disease ◽

10.1094/pdis-92-6-0975b ◽

2008 ◽

Vol 92 (6) ◽

pp. 975-975 ◽

Cited By ~ 6

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

S. Frati ◽

M. L. Gullino

Keyword(s):

United States ◽

Powdery Mildew ◽

Its Region ◽

The United States ◽

Flowering Plant ◽

Pathogenicity Test ◽

Public Park ◽

First Report ◽

Golovinomyces Cichoracearum ◽

Blastn Analysis

Rudbeckia fulgida (orange coneflower), a flowering plant belonging to the Asteraceae, is increasingly used as a border in parks and gardens. In September 2007, severe outbreaks of a previously unknown powdery mildew were observed on plants in a public park in Torino (northern Italy). More than 90% of the plants were affected by the disease. Both surfaces of leaves of affected plants were covered with white mycelia and conidia. As the disease progressed, infected leaves turned yellow and wilted. Mycelia and conidia also were observed on stems and flower calyxes. Conidia were hyaline, ellipsoid, borne in chains (as many as three to four conidia per chain) and measured 34 × 23 (30 to 39 × 21 to 25) μm. Conidiophores measured 129 × 12 (89 to 181 × 11 to 13) μm and showed a foot cell measuring 88 × 12 (48 to 129 × 11 to 13) μm followed by two shorter cells. Fibrosin bodies were absent. Chasmothecia were not observed in the collected samples. The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 619 bp showed a 100% homology with the sequence of Golovinomyces cichoracearum (3). The nucleotide sequence has been assigned GenBank Accession No. EU 233820. Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy R. fulgida plants. Twenty plants were inoculated. Fifteen noninoculated plants served as the control. Plants were maintained in a greenhouse at temperatures ranging from 18 to 22°C. Eight days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. The fungus observed on inoculated plants was morphologically identical to that originally observed. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on R. fulgida in Italy. Powdery mildew on Rudbeckia spp. was previously reported in the United States (4), Poland, and more recently, India and Switzerland. Particularly, in Switzerland the disease has been observed on R. laciniata and R. nitida (2). The economic importance of this disease is currently limited. Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. Bolay. Cryptogam. Helv. 20:1, 2005. (3) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000. (4) D. F. Farr et al. Page 82 in: Fungi on Plants and Plants Products in the United States. The American Phytopathological Society, St Paul, MN, 1989.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces magnicellulatus var. magnicellulatus on Physalis alkekengi var. franchetii in China

Plant Disease ◽

10.1094/pdis-03-13-0328-pdn ◽

2013 ◽

Vol 97 (10) ◽

pp. 1382-1382 ◽

Cited By ~ 2

Author(s):

C. Liang ◽

H. H. Xing ◽

Z. Liu ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

Powdery Mildew ◽

Sequence Data ◽

Morphological Characteristics ◽

Its Region ◽

The United States ◽

Chinese Isolate ◽

Its Sequence ◽

Pathogenicity Test ◽

First Report ◽

Powdery Mildews

Physalis alkekengi var. franchetii (Mast.) Makino, known as Chinese lantern, belonging to Solanaceae, is cultivated for its fruits of medicinal value in East Asia (4). Since July 2010, a powdery mildew has been continuously observed on this plant in Shenyang City in northeastern China. More than 90% of the plants in a garden were affected. Symptoms first appeared as circular to irregular white patches, which progressed to abundant mycelial growth on both sides of leaves and young stems. In the middle of August, chasmothecia were formed abundantly, especially on the lower leaf surface. Voucher specimens were deposited in the herbarium of Qingdao Agricultural University (HMQAU10014, 12047, and 12144). Conidiophores produced 2 to 5 conidia in chains with a sinuate outline, followed by 2 to 3 cells. Foot-cells of conidiophores were straight and 46 to 65 × 9 to 11 μm. Conidia were ellipsoid to barrel-shaped, 26 to 32 × 13 to 15.5 μm, lacked distinct fibrosin bodies, and produced germ tubes on the subterminal position. Chasmothecia were amphigenous, also cauligenous, 100 to 140 μm across, and contained 10 to 25 asci. Appendages were mycelioid, 0.5 to 4 times as long as the chasmothecial diameter, and 1- to 3-septate. Asci were short-stalked, 45 to 64 × 26 to 34 μm, and contained two ascospores of 18 to 25 × 12.5 to 15 μm. The internal transcribed spacer (ITS) region of rDNA was amplified (3) and sequenced. The resulting 600-bp sequence was deposited in GenBank (Accession No. KC488260). A GenBank BLAST search of complete ITS sequence showed 100% identity with that of Golovinomyces orontii on P. alkekengi var. franchetii (AB077647 ex Japan) and >99% similarity with those of G. magnicellulatus on Phlox paniculata (AB077621 ex Japan, AF011303 ex the United States, and GU945756 and GU945757 ex Korea). G. orontii is currently confined to the Golovinomyces isolates on Cichorioideae (1). On the basis of the morphological characteristics and ITS sequence data, the fungus was identified as G. magnicellulatus var. magnicellulatus (U. Braun) V.P. Heluta (1). It was already noted that Golovinomyces isolates on Physalis and Phlox are phylogenetically close each other (3). A pathogenicity test was conducted by gently pressing a diseased leaf onto leaves of five healthy Chinese lanterns. Five non-inoculated plants served as controls. Inoculated plants developed symptoms after 8 days, whereas the control plants remained symptomless. The fungus present on the inoculated plants was morphologically identical to that originally observed on diseased plants, fulfilling Koch's postulates. Powdery mildews of Chinese lantern associated with Golovinomyces species have been known in Korea and Japan (2). A Korean material of Golovinomyces sp. on P. alkekengi var. franchetii was identified as G. magnicellulatus var. magnicellulatus based on morphological characteristics and 100% ITS sequence identity with a Chinese isolate (Shin, unpublished data). To our knowledge, this is the first report of powdery mildew caused by G. magnicellulatus var. magnicellulatus on Chinese lantern in China. References: (1) U. Braun and R. T. A. Cook. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series No.11. CBS, Utrecht, 2012. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, retrieved March 22, 2013. (3) S. Matsuda and S. Takamatsu. Mol. Phylogen. Evol. 27:314, 2003. (4) Y. Zheng et al. Phytochem. Anal. 23:337, 2012.

Download Full-text

When forms meet genes: revision of the scleractinian genera Micromussa and Homophyllia (Lobophylliidae) with a description of two new species and one new genus

Contributions to Zoology ◽

10.1163/18759866-08504002 ◽

2016 ◽

Vol 85 (4) ◽

pp. 387-422 ◽

Cited By ~ 16

Author(s):

Roberto Arrigoni ◽

Francesca Benzoni ◽

Danwei Huang ◽

Hironobu Fukami ◽

Chaolun Allen Chen ◽

...

Keyword(s):

New Genus ◽

Nuclear Dna ◽

New Caledonia ◽

Sequence Data ◽

Intergenic Spacer ◽

Taxonomic Revision ◽

Its Region ◽

Distinct Species ◽

Morphological Data ◽

Eastern Australia

The scleractinian family Lobophylliidae is undergoing a major taxonomic revision thanks to the combination of molecular and morphological data. In this study, we investigate the evolutionary relationships and the macro- and micromorphology of six nominal coral species belonging to two of the nine molecular clades of the Lobophylliidae, clades A and B, and of Symphyllia wilsoni, a lobophylliid species analyzed from a molecular point of view for the first time. Sequence data from mitochondrial DNA (COI and the intergenic spacer between COI and l-rRNA), and nuclear DNA (histone H3 and ITS region) are used to generate robust molecular phylogenies and a median-joining haplotype network. Molecular results are strongly in agreement with detailed observations of gross- and fine-scale morphology of skeletons, leading to the formal revision of the genera Micromussa and Homophyllia and the description of two newly discovered zooxanthellate shallow-water species, Micromussa pacifica sp. nov. Benzoni & Arrigoni and Micromussa indiana sp. nov. Benzoni & Arrigoni, and a new genus, Australophyllia gen. nov. Benzoni & Arrigoni. In particular, Acanthastrea lordhowensis and Montastraea multipunctata are moved into Micromussa, A. hillae is synonymized with A. bowerbanki and is transferred to Homophyllia, and a revised diagnosis for both genera is provided. Micromussa pacifica sp. nov. is described from the Gambier Islands with its distribution spanning New Caledonia and eastern Australia. Despite a superficial resemblance with Homophyllia australis, it has distinctive macroand micromorphological septal features. Micromussa indiana sp. nov., previously identified as M. amakusensis, is here described from the Gulf of Aden and the southern Red Sea as a distinct species that is genetically separated from M. amakusensis and is morphologically distinct from the latter due to its smaller corallite size and lower number of septa. Finally, molecular trees show that S. wilsoni is closely related, but molecularly separated from clades A and B, and, also based on a unique combination of corallite and sub-corallite characters, the species is moved into Australophyllia gen. nov. These findings confirm the need for using both genetic and morphological datasets for the ongoing taxonomic revision of scleractinian corals.

Download Full-text