scholarly journals First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 633-633 ◽  
Author(s):  
H.-Y. Liu ◽  
J. L. Sears
Keyword(s):  
United States ◽  
The United States ◽  
Rt Pcr ◽  
Spot Virus ◽  
Chenopodium Amaranticolor ◽  
Tomato Plants ◽  
First Report ◽  
Chenopodium Murale ◽  
Tomato Field ◽  
Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

scholarly journals First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 113-113 ◽  
Author(s):  
H. F. Schwartz ◽  
K. Otto ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Allium Porrum ◽  
Rt Pcr ◽  
Spot Virus ◽  
Disease Symptoms ◽  
First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

scholarly journals First Report of Natural Infection of Greenhouse Tomatoes by Potato spindle tuber viroid in the United States

Plant Disease ◽  
2010 ◽  
Vol 94 (11) ◽  
pp. 1376-1376 ◽  
Author(s):  
K.-S. Ling ◽  
D. Sfetcu
Keyword(s):  
United States ◽  
Potato Spindle Tuber Viroid ◽  
The United States ◽  
Mechanical Transmission ◽  
Rt Pcr ◽  
Tomato Plants ◽  
First Report ◽  
Viroid Infection ◽  
Plant Pathol ◽  
Greenhouse Tomatoes

In April 2009, a large number of tomato plants (Solanum lycopersicum L.) grown in a commercial greenhouse facility near Los Angles, CA exhibited general plant stunting (short internodes) and foliar symptoms that included distortion, chlorosis, and scattered necrotic spotting. Over time, the leaves began to exhibit a purple color and curling. Diseased plants were often elongated and frail with spindly shoots. The disease resulted in a significant yield loss due to reduced fruit size. Disease symptoms described above are generally different from those of Pepino mosaic virus (PepMV) infection, which causes yellow mosaic or patches on leaves and marbling of fruits. The disease was initially localized in certain areas in a greenhouse despite using a number of cultural management efforts including vigorous scouting, roguing of diseased plants, and strict hygiene and cleaning practices. The disease was also observed in neighboring greenhouses by the spring of 2010. A standard panel of tests for common tomato viruses and viroids were conducted using the appropriate serological or PCR assays. Reverse transcription (RT) PCR analysis of nine symptomatic plants with pospiviroid-specific primers, Pospil-RE and Pospil-FW (3), produced an amplicon of the expected size (~196 bp) while three healthy looking tomato plants did not. Subsequently, full viroid genomic sequences were obtained through RT-PCR with primer sets specific for Potato spindle tuber viroid (PSTVd), 3H1/2H1 (2), as well as for the pospiviroid genus, MTTVd-F and MTTVd-R (1). Sequences obtained from direct sequencing of amplicons or cloned PCR products from one isolate were identical and consisted of a full viroid genome of 358 nt, which was named PSTVd-CA1 (GenBank Accession No. HM753555). BLASTn queries of the NCBI database showed that this isolate had a high sequence identity (98%) to other PSTVd isolates (i.e., EF044304, X52037, and Y09577). The disease was reproducible upon mechanical transmission (1) on three tomato ‘Moneymaker’ plants, which expressed symptoms that were similar to those on the source plants. Recovery of PSTVd on the inoculated tomato plants was confirmed by RT-PCR and sequencing. Because of its susceptibility to viroid infection, tomato ‘Moneymaker’ plants are commonly used as indicators for the study of pospiviroids, including PSTVd. Natural PSTVd infection on greenhouse tomatoes has been reported in Europe (3) and New Zealand. Although a number of reports in the United States have been published on naturally occurring PSTVd infections of potatoes, to our knowledge, this is the first report of a natural PSTVd infection on tomatoes in the United States. The exact source of the PSTVd inoculum in the current disease outbreak is unknown, but it could have been introduced from infected potato or ornamental plants (4) or through infected tomato seeds. The disease epidemic might have been enhanced by frequent hands-on activities in greenhouse tomato production and the environmental conditions (high temperature and intense lighting) in the greenhouse that favor symptom expression. References: (1) K.-S. Ling and W. Zhang, Plant Dis. 93:1216, 2009. (2). A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (4) J. Th. J. Verhoeven et al. Plant Pathol. 59:3, 2010.

scholarly journals First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 701-701
Author(s):  
K.-S. Ling ◽  
R. Li ◽  
D. Groth-Helms ◽  
F. M. Assis-Filho
Keyword(s):  
United States ◽  
Dominican Republic ◽  
Mosaic Virus ◽  
Potato Spindle Tuber Viroid ◽  
The United States ◽  
Disease Outbreak ◽  
Ringspot Virus ◽  
Rt Pcr ◽  
Spot Virus ◽  
Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

scholarly journals First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 762-762 ◽  
Author(s):  
R. K. Sampangi ◽  
C. Almeyda ◽  
K. L. Druffel ◽  
S. Krishna Mohan ◽  
C. C. Shock ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Great Basin ◽  
Natural Infection ◽  
The United States ◽  
Native Plant ◽  
Rt Pcr ◽  
Cmv Infection ◽  
Spot Virus ◽  
First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

scholarly journals First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 468-468 ◽  
Author(s):  
D. H. Gent ◽  
R. R. Martin ◽  
C. M. Ocamb
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
First Report ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

scholarly journals First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Gardenia Orellana ◽  
Alexander V Karasev
Keyword(s):  
United States ◽  
Leaf Tissue ◽  
The United States ◽  
Universal Primers ◽  
Rt Pcr ◽  
Universal Primer ◽  
Tissue Samples ◽  
First Report ◽  
Specific Pcr ◽  
Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

scholarly journals Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 292-297 ◽  
Author(s):  
Mohamad Chikh-Ali ◽  
Hayam Alruwaili ◽  
Dalton Vander Pol ◽  
Alexander V. Karasev
Keyword(s):  
United States ◽  
Saudi Arabia ◽  
Seed Potato ◽  
Potato Virus ◽  
Potato Virus Y ◽  
The United States ◽  
Tuber Quality ◽  
Rt Pcr ◽  
First Report ◽  
Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

scholarly journals First Report of Iris yellow spot virus on Onion in New York

Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 327-327 ◽  
Author(s):  
C. A. Hoepting ◽  
H. F. Schwartz ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
New York ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Onion Thrips ◽  
Spot Virus ◽  
First Report

Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), a potentially devastating disease of onion vectored by onion thrips (Thrips tabaci Lindeman), has been reported from most states in the western United States where significant onion production occurs, with the most recent report from Texas (1). In June 2006, volunteer onion (Allium cepa) plants in Orleans County, New York (Elba muckland) were found to have symptoms indicative of IYSV infection. The scapes (seed stalks) of the volunteer onions found at the edge of a cull pile from a 2005 onion crop exhibited diamond-shaped lesions, each with a distinct green center and a double yellow border. Approximately 25 of 100 plants of red and yellow onion cultivars exhibited characteristic IYSV lesions. The cull pile was composed primarily of locally grown onions, although a few of the bulbs were grown from imported bare-root transplants imported from Arizona. Symptomatic plants tested positive for IYSV using IYSV-specific antiserum from Agdia Inc. (Elkhart, IN) in a double-antibody sandwich-ELISA. The presence of IYSV was verified by reverse transcription (RT)-PCR using primers derived from the small RNA of IYSV (S-RNA). The primers flanked the IYSV nucleocapsid (N) gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′ (3). RT-PCR assays produced a PCR amplicon of expected size (approximately 1.2 kb) and the product was cloned and sequenced. Nucleotide sequence analysis confirmed the identity of the amplicon as that of the IYSV S-RNA. Sequence comparisons showed 95 to 98% identity with known IYSV N gene sequences available in GenBank. The virus is poorly transmitted to onion by mechanical inoculation and we did not have access to a noninfested colony of the onion thrips vector to transfer the virus from these samples to noninfected onions. No asymptomatic plants were tested. Among the onion-growing states in the eastern United States, IYSV has previously only been reported from Georgia (2). To our knowledge, this is the first report of IYSV in New York and the greater northeastern United States. The finding of this disease in New York confirms further spread of the virus within North America and the need for research to develop more effective management options to reduce the impact of IYSV on onion crops. References: (1) M. Miller et al. Plant Dis. 90:1359, 2006. (2) S. W. Mullis et al. Plant Dis. 90:377, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006.

Sign in / Sign up

Export Citation Format

Share Document