scholarly journals Tomato yellow leaf curl virus in Tomato in Texas, Originating from Transplant Facilities

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 466-466 ◽  
Author(s):  
T. Isakeit ◽  
A. M. Idris ◽  
G. Sunter ◽  
M. C. Black ◽  
J. K. Brown
Keyword(s):  
Rolling Circle Amplification ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Bipartite Begomovirus ◽  
Subtropical Climate ◽  
Yellow Leaf ◽  
Fresh Market ◽  
Hidalgo County ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a monopartite virus in the genus Begomovirus (family, Geminiviridae) from the Middle East, is one of the most damaging whitefly-transmitted viruses of tomato (Lycopersicon esculentum) worldwide. TYLCV was first identified in the United States in 1997 in Florida (4), and most recently, in the Pacific Coast states of Mexico where fresh market tomatoes are grown for the U.S. market (1). During September 2006, tomatoes grown from transplants in Waller County, TX exhibited shortened internodes, stunting and puckering of leaflets, green vein banding, and diffuse chlorosis. The disease incidence in two fields (4 ha total) was 95% and yield was substantially reduced. Many of the transplants were symptomatic at planting. The transplants originated from two facilities in Hidalgo County, TX. Both facilities had experienced heavy infestations of the whitefly, Bemisia tabaci (Genn.), during transplant production. At the same time, transplants produced in Uvalde and Bexar counties, TX, where whitefly infestations were also prevalent, had similar virus symptoms. Total DNA was extracted from the leaves of symptomatic tomato plants from 10 samples from these four counties and amplified by PCR (2). DNA samples from Waller, Hidalgo, and Uvalde counties were cloned, and a partial fragment of the viral coat protein gene (core Cp) was sequenced. BLAST analysis of the core Cp sequences of each sample confirmed the presence of TYLCV. No other begomovirus was detected, and all attempts to amplify a bipartite begomovirus by PCR using degenerate DNA-B specific primers (3) were unsuccessful. The full-length TYLCV DNA was amplified from three samples using the rolling circle amplification method as described (1), cloned, and the sequences were determined. The three sequences shared 99.6 to 100% nt identity and so only one sequence was deposited in the NCBI GenBank database (Accession No. EF110890) (1). Analysis of the complete genome nucleotide sequence corroborated TYLCV identity predicted by core Cp analysis that was 98.1% identical with TYLCV from Egypt (GenBank Accession No. AY594174) and Spain (GenBank Accession No. AJ489258), 97.6% with TYLCV from Mexico (GenBank Accession No. DQ631892), and 96.5% with TYLCV-Is (GenBank Accession No. X15656). Additionally, a Southern blot with TYLCV as the probe detected replicating (double-stranded) TYLCV DNA in all samples consisting of three plants from Uvalde County and 21 plants from Bexar County. To our knowledge, this is the first report of TYLCV in Texas that occurred in two transplant production areas approximately 400 km apart. Transplants produced in Uvalde and Bexar counties were planted there, while Hidalgo County transplants were shipped outside of the usual range of the whitefly. Hidalgo County has a subtropical climate, which can allow overwintering of TYLCV and the whitefly vector, allowing the establishment and spread of this virus in the future. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. K. Brown et al. Arch. Virol. 146:1581, 2001. (3) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (4) J. E. Polston et al. Plant Dis. 83:984, 1999.

scholarly journals Introduction of the Exotic Monopartite Tomato yellow leaf curl virus into West Coast Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (10) ◽  
pp. 1360-1360 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris
Keyword(s):  
United States ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Caribbean Region ◽  
Yellow Leaf ◽  
Fresh Market ◽  
Tomato Production ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Leaf curl symptoms that are reminiscent of begomovirus (genus Begomovirus, family Geminiviridae) infection were observed widespread in the tomato crop during the early fall 2005 through the spring 2006 growing seasons in Sinaloa State, Mexico. Symptoms were widespread in three major valleys (Culiacan, Guasave, and Los Mochis) that are largely dedicated to fresh-market tomato production for the U.S. market from October to June. Symptoms included stunting of leaves, shortened internodes, distortion of leaf margins, and green vein banding. Fruit set was reduced significantly (as much as 90%) on the portion of the plant that developed above the point of symptom expression. Tomato fields were heavily infested with the B biotype of the whitefly Bemisia tabaci (Genn.) vector and no other insect vectors were noted in the fields. Total DNA was extracted from six symptomatic tomato plants (two from each valley) and used as template to amplify, clone, and sequence the core region of the begomovirus CP. BLAST analysis of begomovirus sequences available in the NCBI GenBank database indicated the closest match was the Old World monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) from Israel (Accession No. X15656) at 97.8% shared nucleotide (nt) identity. The full-length genome was amplified for each of six isolates using TempliPhi (Amersham Biosciences, Piscataway, NJ) and cloned into the pGEM7 vector (Promega, Madison, WI). The complete DNA genome sequence was determined for eight clones by primer walking. Cloned TempliPhi products sequenced represented two to three isolates from each valley. Results indicated that the isolates (n = 8) were 98.9 to 100% identical (Accession No. DQ631892) to each other, and they shared 98% identity with TYLCV isolates reported from the Caribbean Region and Florida. This highly virulent begomovirus of tomato, originating in Israel, was first reported in Mexico from 1996 to 1997 when it was identified in tomato plants in the Yucatan Peninsula (1) (>1,500 miles from Sinaloa). The latter report followed the introduction of TYLCV in tomato seedlings from Florida into several eastern U.S. states (3,4) and then into Puerto Rico (2). The introduction of TYLCV into Sinaloa where tomato production is highly concentrated is significant because the region supplies the majority (as much as 93%) of fresh-market tomatoes to the western United States from October to June (>$750 million dollars). Of equal importance is the immediate proximity of the pandemic to California where more than 90% of the processing tomatoes in the United States are grown. References: (1) J. T. Ascencio-Ibáñez et al. Plant Dis. 83:1178, 1999. (2) J. Bird et al. Plant Dis. 85:1028, 2001. (3) M. T. Momol et al. Plant Dis 83:487, 1999. (4) J. E. Polston and P. K. Anderson, Plant Dis. 81:1358, 1997.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky

2008 ◽  
Vol 9 (1) ◽  
pp. 12 ◽  
Author(s):  
P. B. de Sá ◽  
K. W. Seebold ◽  
P. Vincelli
Keyword(s):  
Pathogen Detection ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
The State ◽  
Yellow Leaf ◽  
Greenhouse Production ◽  
Tomato Plants ◽  
Detection Approach ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state. Accepted for publication 17 June 2008. Published 19 August 2008.

scholarly journals Tomato Yellow Leaf Curl Virus-Is Causes a Novel Disease of Common Bean and Severe Epidemics in Tomato in Spain

Plant Disease ◽  
1999 ◽  
Vol 83 (1) ◽  
pp. 29-32 ◽  
Author(s):  
Jesús Navas-Castillo ◽  
Sonia Sánchez-Campos ◽  
Juan Antonio Díaz ◽  
Elisa Sáez-Alonso ◽  
Enrique Moriones
Keyword(s):  
Common Bean ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Fresh Market ◽  
First Report ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Field surveys were conducted in the autumn of 1997 in the main tomato (Lycopersicon esculentum)-growing regions of southern Spain following a severe tomato yellow leaf curl epidemic in tomato. Tomato yellow leaf curl virus (TYLCV)-Is was found to have spread to all regions and to coexist with TYLCV-Sr, which has been present since 1992. TYLCV-Is was also shown to be the causal agent of bean leaf crumple, a novel disease that has caused severe economic losses in fresh-market common bean (Phaseolus vulgaris) crops of southern Spain since September 1997. The disease was reproduced by infecting beans with cloned TYLCV-Is obtained from infected tomato plants collected in Almería. This is the first report of bean leaf crumple disease and the first report of a geminivirus in bean from Spain.

scholarly journals Introduction of Tomato Yellow Leaf Curl Virus in Florida and Implications for the Spread of This and Other Geminiviruses of Tomato

Plant Disease ◽  
1999 ◽  
Vol 83 (11) ◽  
pp. 984-988 ◽  
Author(s):  
J. E. Polston ◽  
R. J. McGovern ◽  
L. G. Brown
Keyword(s):  
Management Practices ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
The State ◽  
Restriction Enzyme Digestion ◽  
Dade County ◽  
Yellow Leaf ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

In July 1997, symptoms characteristic of tomato yellow leaf curl virus (TYLCV-Is) were observed on one tomato plant in a field in Collier County, Florida, and on several tomato plants in a retail garden center in Sarasota, Florida. Amplification with three sets of primers, analysis of amplified fragments using restriction enzyme digestion, and hybridization with a clone of TYLCV-Is indicated that TYLCV-Is was present in symptomatic plants. The sequence of a 1,300-bp amplified fragment was 99% identical to TYLCV-Is from the Dominican Republic and 98% identical to an isolate from Israel. It appears that TYLCV-Is entered the United States in Dade County, Florida, in late 1996 or early 1997. Subsequently, infected tomato transplants produced for retail sale at two Dade County facilities were rapidly distributed via retail garden centers throughout the state. Infected plants purchased by homeowners and placed in and around homes appeared to be the source of TYLCV-Is for nearby commercial nurseries and production fields. It appears that transplants have played a role in the movement of this and probably other geminiviruses. A number of regulatory procedures, as well as field management practices, were implemented in the 1997-98 production season to minimize the movement of TYLCV-Is within and out of the state.

scholarly journals First Report of Tomato yellow leaf curl Kanchanaburi virus Infecting Eggplant in Laos

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 428-428 ◽  
Author(s):  
Y. F. Tang ◽  
Z. F. He ◽  
Z. G. Du ◽  
L. H. Lu
Keyword(s):  
Rolling Circle Amplification ◽  
Mosaic Disease ◽  
Tomato Yellow Leaf ◽  
Full Length ◽  
Bipartite Begomovirus ◽  
Yellow Leaf ◽  
Putative Orfs ◽  
Rolling Circle ◽  
First Report ◽  
Leaf Curl

Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) reported to infect tomato and eggplant in Thailand and Vietnam (1,2). In April 2013, eggplant (Solanum melongena L.) plants exhibiting yellow mosaic symptoms were found in a suburb of Vientiane, Laos. Three symptomatic samples were collected. Total DNA was extracted from leaves by the CTAB method, and used as template for PCR using the degenerate primer pair AV494/CoPR (3). The PCR results suggested that the plants were infected by a begomovirus. The begomoviral genome was amplified by rolling circle amplification (RCA) with TempliPhi kit (GE Healthcare) following the manufacturer's protocol. RCA product was digested with the endonucleases BamH I, EcoR I, Hind III, Kpn I, Pst I, and Xba I, respectively. The fragments about 2.1 kbp (with Pst I digestion) and 1.5 kbp (with Xba I digestion) in size were cloned and sequenced. The sequence of the 2.1-kbp fragment showed similarity with begomovirus DNA-A component. A pair of primers for amplification of the full-length DNA-A, AF (5′-CTTCATCGTTTCTCAGCATCAT-3′) and AR (5′-CACTTGCACACGATCTCTAAGA-3′) were designed from the 2.1-kbp sequence. The full-length DNA-A was 2,752 nucleotides and encoded six putative ORFs (GenBank Accession No. KF218820). The sequence of the 1.5-kbp fragment shared similarity with begomoviruses DNA-B. The begomoviral circular DNA-B was amplified using the pair of primers BF (5′-GTAACAGCCGAAGTGCACG-3′) and BR (5′-AATGGAGAGACACCAGTCTGCC-3′) designed from the 1.5-kbp sequence. PCR yielded a product of expected size (~1.4 kbp). The full-length DNA-B sequence was obtained by assembling the two sequences. The DNA-B was 2,734 nucleotides and encoded two putative ORFs (GenBank Accession No. KF218821). The sequences of DNA-A and DNA-B of isolate Laos shared the highest nucleotide sequences identities at 99.0% and 98.0% with those of TYLCKaV-[TH:Kan 1:01] (AF511529), and [TH:Kan 2:Egg:01] (AF511527), respectively. The results indicated that the virus associated with eggplant yellow mosaic disease was an isolate of TYLCKaV. To our knowledge, this is the first report of this begomovirus in Laos. Our results indicate that this virus may be spreading in Southeast Asia and scientists there should be aware of this virus when developing begomovirus-resistant varieties of tomato or eggplant. References: (1) S. K. Green et al. Plant Dis. 87:446, 2003. (2) C. Ha et al. J. Gen. Virol. 89:312, 2008.(3) Z. F. He et al. Arch. Virol. 154:1199, 2009.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Tomato, Tomatillo, and Peppers in Guatemala

Plant Disease ◽  
2010 ◽  
Vol 94 (4) ◽  
pp. 482-482 ◽  
Author(s):  
R. Salati ◽  
M. Shorey ◽  
A. Briggs ◽  
J. Calderon ◽  
M. R. Rojas ◽  
...  
Keyword(s):  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Full Length ◽  
Bipartite Begomovirus ◽  
Yellow Leaf ◽  
Sequence Analyses ◽  
Degenerate Primers ◽  
Begomovirus Infection ◽  
Leaf Curl Virus ◽  
Leaf Curl

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts. References: (1) M. K. Nakhla et al. Acta Hortic. 695:277, 2005. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) R. Salati et al. Phytopathology 92:487, 2002. (4) S. D. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

Sign in / Sign up

Export Citation Format

Share Document