Introduction of the Exotic Monopartite Tomato yellow leaf curl virus into West Coast Mexico

Leaf curl symptoms that are reminiscent of begomovirus (genus Begomovirus, family Geminiviridae) infection were observed widespread in the tomato crop during the early fall 2005 through the spring 2006 growing seasons in Sinaloa State, Mexico. Symptoms were widespread in three major valleys (Culiacan, Guasave, and Los Mochis) that are largely dedicated to fresh-market tomato production for the U.S. market from October to June. Symptoms included stunting of leaves, shortened internodes, distortion of leaf margins, and green vein banding. Fruit set was reduced significantly (as much as 90%) on the portion of the plant that developed above the point of symptom expression. Tomato fields were heavily infested with the B biotype of the whitefly Bemisia tabaci (Genn.) vector and no other insect vectors were noted in the fields. Total DNA was extracted from six symptomatic tomato plants (two from each valley) and used as template to amplify, clone, and sequence the core region of the begomovirus CP. BLAST analysis of begomovirus sequences available in the NCBI GenBank database indicated the closest match was the Old World monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) from Israel (Accession No. X15656) at 97.8% shared nucleotide (nt) identity. The full-length genome was amplified for each of six isolates using TempliPhi (Amersham Biosciences, Piscataway, NJ) and cloned into the pGEM7 vector (Promega, Madison, WI). The complete DNA genome sequence was determined for eight clones by primer walking. Cloned TempliPhi products sequenced represented two to three isolates from each valley. Results indicated that the isolates (n = 8) were 98.9 to 100% identical (Accession No. DQ631892) to each other, and they shared 98% identity with TYLCV isolates reported from the Caribbean Region and Florida. This highly virulent begomovirus of tomato, originating in Israel, was first reported in Mexico from 1996 to 1997 when it was identified in tomato plants in the Yucatan Peninsula (1) (>1,500 miles from Sinaloa). The latter report followed the introduction of TYLCV in tomato seedlings from Florida into several eastern U.S. states (3,4) and then into Puerto Rico (2). The introduction of TYLCV into Sinaloa where tomato production is highly concentrated is significant because the region supplies the majority (as much as 93%) of fresh-market tomatoes to the western United States from October to June (>$750 million dollars). Of equal importance is the immediate proximity of the pandemic to California where more than 90% of the processing tomatoes in the United States are grown. References: (1) J. T. Ascencio-Ibáñez et al. Plant Dis. 83:1178, 1999. (2) J. Bird et al. Plant Dis. 85:1028, 2001. (3) M. T. Momol et al. Plant Dis 83:487, 1999. (4) J. E. Polston and P. K. Anderson, Plant Dis. 81:1358, 1997.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky

Plant Health Progress ◽

10.1094/php-2008-0819-01-rs ◽

2008 ◽

Vol 9 (1) ◽

pp. 12 ◽

Cited By ~ 3

Author(s):

P. B. de Sá ◽

K. W. Seebold ◽

P. Vincelli

Keyword(s):

Pathogen Detection ◽

The United States ◽

Tomato Yellow Leaf ◽

The State ◽

Yellow Leaf ◽

Greenhouse Production ◽

Tomato Plants ◽

Detection Approach ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state. Accepted for publication 17 June 2008. Published 19 August 2008.

Download Full-text

Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽

10.1094/pdis-02-14-0144-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1017-1017 ◽

Cited By ~ 2

Author(s):

G. Anfoka ◽

F. Haj Ahmad ◽

M. Altaleb ◽

M. Al Shhab

Keyword(s):

Mixed Infection ◽

Tomato Yellow Leaf ◽

Single Infection ◽

Yellow Leaf ◽

Tomato Production ◽

Tomato Plants ◽

Pcr Products ◽

Leaf Curl Virus ◽

Leaf Curl Disease ◽

Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

Download Full-text

Tomato yellow leaf curl virus in Tomato in Texas, Originating from Transplant Facilities

Plant Disease ◽

10.1094/pdis-91-4-0466a ◽

2007 ◽

Vol 91 (4) ◽

pp. 466-466 ◽

Cited By ~ 9

Author(s):

T. Isakeit ◽

A. M. Idris ◽

G. Sunter ◽

M. C. Black ◽

J. K. Brown

Keyword(s):

Rolling Circle Amplification ◽

The United States ◽

Tomato Yellow Leaf ◽

Bipartite Begomovirus ◽

Subtropical Climate ◽

Yellow Leaf ◽

Fresh Market ◽

Hidalgo County ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a monopartite virus in the genus Begomovirus (family, Geminiviridae) from the Middle East, is one of the most damaging whitefly-transmitted viruses of tomato (Lycopersicon esculentum) worldwide. TYLCV was first identified in the United States in 1997 in Florida (4), and most recently, in the Pacific Coast states of Mexico where fresh market tomatoes are grown for the U.S. market (1). During September 2006, tomatoes grown from transplants in Waller County, TX exhibited shortened internodes, stunting and puckering of leaflets, green vein banding, and diffuse chlorosis. The disease incidence in two fields (4 ha total) was 95% and yield was substantially reduced. Many of the transplants were symptomatic at planting. The transplants originated from two facilities in Hidalgo County, TX. Both facilities had experienced heavy infestations of the whitefly, Bemisia tabaci (Genn.), during transplant production. At the same time, transplants produced in Uvalde and Bexar counties, TX, where whitefly infestations were also prevalent, had similar virus symptoms. Total DNA was extracted from the leaves of symptomatic tomato plants from 10 samples from these four counties and amplified by PCR (2). DNA samples from Waller, Hidalgo, and Uvalde counties were cloned, and a partial fragment of the viral coat protein gene (core Cp) was sequenced. BLAST analysis of the core Cp sequences of each sample confirmed the presence of TYLCV. No other begomovirus was detected, and all attempts to amplify a bipartite begomovirus by PCR using degenerate DNA-B specific primers (3) were unsuccessful. The full-length TYLCV DNA was amplified from three samples using the rolling circle amplification method as described (1), cloned, and the sequences were determined. The three sequences shared 99.6 to 100% nt identity and so only one sequence was deposited in the NCBI GenBank database (Accession No. EF110890) (1). Analysis of the complete genome nucleotide sequence corroborated TYLCV identity predicted by core Cp analysis that was 98.1% identical with TYLCV from Egypt (GenBank Accession No. AY594174) and Spain (GenBank Accession No. AJ489258), 97.6% with TYLCV from Mexico (GenBank Accession No. DQ631892), and 96.5% with TYLCV-Is (GenBank Accession No. X15656). Additionally, a Southern blot with TYLCV as the probe detected replicating (double-stranded) TYLCV DNA in all samples consisting of three plants from Uvalde County and 21 plants from Bexar County. To our knowledge, this is the first report of TYLCV in Texas that occurred in two transplant production areas approximately 400 km apart. Transplants produced in Uvalde and Bexar counties were planted there, while Hidalgo County transplants were shipped outside of the usual range of the whitefly. Hidalgo County has a subtropical climate, which can allow overwintering of TYLCV and the whitefly vector, allowing the establishment and spread of this virus in the future. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. K. Brown et al. Arch. Virol. 146:1581, 2001. (3) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (4) J. E. Polston et al. Plant Dis. 83:984, 1999.

Download Full-text

Two Distinct Isolates of Tomato yellow leaf curl virus Threaten Tomato Production in Arizona and Sonora, Mexico

Plant Disease ◽

10.1094/pdis-91-7-0910c ◽

2007 ◽

Vol 91 (7) ◽

pp. 910-910 ◽

Cited By ~ 10

Author(s):

A. M. Idris ◽

J. C. Guerrero ◽

J. K. Brown

Keyword(s):

United States ◽

Pacific Coast ◽

Southeastern United States ◽

Western Hemisphere ◽

Caribbean Region ◽

Yellow Leaf ◽

Tomato Plants ◽

The Caribbean ◽

Leaf Curl Virus ◽

Leaf Curl

Severe yellow leaf curl and plant stunting symptoms were observed in tomato plants from two home gardens in central Arizona (Phoenix area) and a tomato field in Sonora, Mexico during the fall of 2006. Disease symptoms were reminiscent of those reported in Florida during 1994 (4) and more recently in tomato fields in the Pacific Coast state of Sinaloa, Mexico found to be infected with the exotic Tomato yellow leaf curl virus (TYLCV) (2). Total DNA was extracted from two symptomatic tomato plants from Arizona and Sonora and used as a template in PCR. PCR products of the core region of the begomovirus coat protein gene (Cp) were cloned (n = 3) and the DNA sequence was determined. BLAST analysis of the 579 bases with sequences available in the NCBI GenBank database indicated the closest match was to an isolate of the monopartite begomovirus TYLCV from Israel, which was known to have been introduced into the Caribbean region, including Puerto Rico, the southeastern United States, and Mexico from 1990 to 1996 (1,4). The full-length TYLCV genome (approximately 2,800 bases) was amplified for a field isolate from each location by rolling circle amplification (RCA) using TempliPhi (Amersham Biosciences, Piscataway, NJ). RCA products were cloned into the plasmid vector pGEM7 (Promega, Madison, WI) that had been previously digested with SacI endonuclease. The complete TYLCV genome sequence was determined for six clones from each RCA product. Nucleotide analysis indicated that the complete TYLCV genome sequences from Sonora and Arizona, respectively, shared 97.6 and 97.7% nt identity. The comparative sequence analysis indicated that TYLCV-Sonora (TYLCV-Son) (GenBank Accession No. EF210555) was 99.1% nt identical to TYLCV reported recently from Culiacan, Mexico (GenBank Accession No. DQ631892). In contrast, TYLCV-AZ (GenBank Accession No. EF210554) shared 99.3% identity with an isolate from Texas, TYLCV-TX (GenBank Accession No. EF110890) (3). Interestingly, the TX and AZ TYLCV isolates contained a unique 29-nt deletion in the intergenic region (IR) between the TATA-box and the nonanucleotide, initiating at nt coordinate 2696. Except for the deletion in the IR region of the AZ and TX isolates, these viruses shared 97.6 to 99.1% nt identity to other TYLCV isolates reported in the Western Hemisphere. The genome sequence for TYLCV-Son shares high nt identity with TYLCV isolates identified in the Yucatan Peninsula and Pacific Coast of Mexico (2), the Caribbean region, and the southeastern United States, suggesting that a single TYLCV species was introduced and has spread throughout North America and the Caribbean (4). The absence of other TYLCV isolates in the Western Hemisphere with the novel 29-nt deletion noted for the TX and AZ isolates suggests that the latter two isolates originated from the same U.S. source. In Mexico, TYLCV was first introduced in the east coast and Yucatan region approximately in 1996. From there, this isolate has spread to the western part of the country (Sinaloa and Sonora) from 2004 to 2006 (2). Similarly, in the United States, TYLCV was introduced and spread in the eastern U.S. states beginning in 1994 (4), where it had been confined until it was discovered in Texas (3) and now Arizona during 2006. References: (1) J. Bird et al. Plant Dis. 85:1028, 2001. (2) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (3) T. Isakeit et al. Plant Dis. 91:466, 2007. (4) J. E. Polston et al. Plant Dis. 78:831, 1994.

Download Full-text

First Report of Tomato yellow leaf curl virus in Mississippi

Plant Disease ◽

10.1094/pdis.2001.85.12.1287c ◽

2001 ◽

Vol 85 (12) ◽

pp. 1287-1287 ◽

Cited By ~ 8

Author(s):

D. M. Ingram ◽

A. Henn

Keyword(s):

Leaf Size ◽

The United States ◽

Tomato Yellow Leaf ◽

Production Operation ◽

Yellow Leaf ◽

Pcr Assay ◽

Tomato Production ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

Download Full-text

First Report of Tomato yellow leaf curl virus in Louisiana

Plant Disease ◽

10.1094/pdis.2001.85.2.230d ◽

2001 ◽

Vol 85 (2) ◽

pp. 230-230 ◽

Cited By ~ 11

Author(s):

R. A. Valverde ◽

P. Lotrakul ◽

A. D. Landry ◽

J. E. Boudreaux

Keyword(s):

The United States ◽

Tomato Yellow Leaf ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Tomato Plants ◽

First Report ◽

Biotype B ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Tomato in South Georgia

Plant Disease ◽

10.1094/pdis.1999.83.5.487c ◽

1999 ◽

Vol 83 (5) ◽

pp. 487-487 ◽

Cited By ~ 19

Author(s):

M. T. Momol ◽

G. W. Simone ◽

W. Dankers ◽

R. K. Sprenkel ◽

S. M. Olson ◽

...

Keyword(s):

Personal Communication ◽

Tomato Yellow Leaf ◽

South Florida ◽

Yellow Leaf ◽

Fresh Market ◽

Tomato Plants ◽

South Georgia ◽

Pcr Product ◽

Leaf Curl Virus ◽

Leaf Curl

In October 1998, symptoms characteristic of tomato yellow leaf curl virus (TYLCV) were observed on fresh market tomato (Lycopersicon esculentum Mill.) in four production fields, two in Decatur County, Georgia, and two in Gadsden County, Florida. Symptoms observed were plant stunting, reduced leaf size, yellow leaf margins, and mottling. The incidence of symptomatic plants was less than 1% in all fields examined. In most cases, symptoms were observed only on the upper portion of plants, suggesting these plants had been infected by secondary spread from an unknown source. Nuclear inclusions characteristic of geminiviruses were observed by light microscopy in leaf tissue from symptomatic plants (1). To identify the geminivirus, total DNA from infected plants was extracted from six symptomatic tomato plants (two from Georgia and four from Florida) for polymerase chain reaction (PCR; J. E. Polston, personal communication). DNA was amplified with geminivirus DNA A degenerate primer set PAL1v1978 and PAR1c496 (2) from these extracts in addition to extracts from a known TYLCV-infected, a tomato mottle virus (ToMoV)-infected, and a healthy tomato plant. A PCR product of 1.4 kb was obtained from plants with TYLCV-like symptoms, while a 1.4-kb product and a 1.1-kb product were obtained from extracts of the known TYLCV-infected and ToMoV-infected tomato plants, respectively. No PCR product was obtained from extracts of healthy tomato plants. The 1.4-kb PCR products from one Georgia sample and one Florida sample were compared with those of TYLCV and ToMoV by restriction enzyme (RE) digestion with EcoRI and ClaI. The RE pattern of the 1.4-kb fragment from both samples was identical to the RE pattern of TYLCV and different from that of ToMoV. Adult and immature whiteflies collected from the fields where TYLCV was found were identified as Bemisia tabaci, the vector of TYLCV, but the biotype was not established. This report of TYLCV in south Georgia and north Florida extends the geographic range of TYLCV in the U.S. northward approximately 100 km. Georgia is the second state in which TYLCV was found since its initial detection in south Florida in July 1997 (J. E. Polston, personal communication). Monitoring of silverleaf whitefly populations and detection of TYLCV on alternate hosts will continue in order to estimate the potential impact of this virus on south Georgia and north Florida agriculture. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986, (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽

10.1094/pdis-09-18-1558-pdn ◽

2019 ◽

Vol 103 (6) ◽

pp. 1437-1437 ◽

Cited By ~ 2

Author(s):

M. Granier ◽

L. Tomassoli ◽

A. Manglli ◽

M. Nannini ◽

M. Peterschmitt ◽

...

Keyword(s):

Resistance Gene ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Virus Recombinant ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

Phytopathology ◽

10.1094/phyto-06-21-0248-r ◽

2021 ◽

Author(s):

Wendy Marchant ◽

Saurabh Gautam ◽

Bhabesh Dutta ◽

Rajagopalbab Srinivasan

Keyword(s):

Amino Acids ◽

Mixed Infection ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Plant Interactions ◽

Tomato Plants ◽

Individual Host ◽

Field Samples ◽

Leaf Curl Virus ◽

Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Download Full-text