scholarly journals Introduction of Tomato Yellow Leaf Curl Virus in Florida and Implications for the Spread of This and Other Geminiviruses of Tomato

Plant Disease ◽  
1999 ◽  
Vol 83 (11) ◽  
pp. 984-988 ◽  
Author(s):  
J. E. Polston ◽  
R. J. McGovern ◽  
L. G. Brown
Keyword(s):  
Management Practices ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
The State ◽  
Restriction Enzyme Digestion ◽  
Dade County ◽  
Yellow Leaf ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

In July 1997, symptoms characteristic of tomato yellow leaf curl virus (TYLCV-Is) were observed on one tomato plant in a field in Collier County, Florida, and on several tomato plants in a retail garden center in Sarasota, Florida. Amplification with three sets of primers, analysis of amplified fragments using restriction enzyme digestion, and hybridization with a clone of TYLCV-Is indicated that TYLCV-Is was present in symptomatic plants. The sequence of a 1,300-bp amplified fragment was 99% identical to TYLCV-Is from the Dominican Republic and 98% identical to an isolate from Israel. It appears that TYLCV-Is entered the United States in Dade County, Florida, in late 1996 or early 1997. Subsequently, infected tomato transplants produced for retail sale at two Dade County facilities were rapidly distributed via retail garden centers throughout the state. Infected plants purchased by homeowners and placed in and around homes appeared to be the source of TYLCV-Is for nearby commercial nurseries and production fields. It appears that transplants have played a role in the movement of this and probably other geminiviruses. A number of regulatory procedures, as well as field management practices, were implemented in the 1997-98 production season to minimize the movement of TYLCV-Is within and out of the state.

First Report of Tomato Yellow Leaf Curl Virus in Greenhouse Tomatoes in Kentucky

2008 ◽  
Vol 9 (1) ◽  
pp. 12 ◽  
Author(s):  
P. B. de Sá ◽  
K. W. Seebold ◽  
P. Vincelli
Keyword(s):  
Pathogen Detection ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
The State ◽  
Yellow Leaf ◽  
Greenhouse Production ◽  
Tomato Plants ◽  
Detection Approach ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), genus Begomovirus in the family Geminiviridae, was identified for the first time in the United States in Florida in 1997 and since then has been reported in other states on tomato in greenhouse and in field production environments. During 2005 symptoms typical of geminivirus infection were observed on tomato plants grown in a greenhouse production system in Jefferson Co., KY. A nucleic acid-based pathogen detection approach was used and TYLCV infection was confirmed in tomato plants collected from the greenhouse and in symptomless Acalypha ostryifolia growing outside the greenhouse. To our knowledge, A. ostryifolia has not been previously described as a host of this virus. This find raises concerns regarding the introduction of TYLCV to the state in infected transplants or in viruliferous whiteflies transported on infested plants, and its potential impact on economically important crops in the state. Accepted for publication 17 June 2008. Published 19 August 2008.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals The Influence of Visual and Olfactory Cues in Host Selection for Bemisia tabaci Biotype B in the Presence or Absence of Tomato Yellow Leaf Curl Virus

Insects ◽  
2020 ◽  
Vol 11 (2) ◽  
pp. 115 ◽  
Author(s):  
Nicholas Johnston ◽  
Xavier Martini
Keyword(s):  
Bemisia Tabaci ◽  
Host Selection ◽  
Tomato Yellow Leaf ◽  
Olfactory Cues ◽  
Yellow Leaf ◽  
Agricultural Pests ◽  
Sensory Stimuli ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

The silverleaf whitefly, Bemisia tabaci, is one of the most destructive agricultural pests in the world, vectoring a large number of devastating viruses, including Tomato Yellow Leaf Curl Virus (TYLCV). When selecting a host, B. tabaci is primarily influenced by a range of visual and olfactory cues. Therefore, elucidating how such cues become modified in the presence of whitefly-vectored begomoviruses is critical to better understanding the epidemiology of many economically important diseases. The goal of this study was to determine how both visual and odor cues interact in the presence of TYLCV. In Y-tube olfactometer assays, whiteflies were submitted to a range of isolated visual and olfactory cues to determine behavioral changes. B. tabaci choices were then compared to both stimuli combined in the presence or absence of TYLCV. Under visual stimuli only, B. tabaci exhibited a visual attraction to the color yellow, TYLCV-infected tomato leaves, and TYLCV-infected tomato volatiles. Attraction was the strongest overall when both visual and olfactory cues from TYLCV-symptomatic tomato plants were combined, as opposed to a single isolated cue. These results highlight the importance of both sensory stimuli during B. tabaci host selection in the presence of an associated begomovirus.

scholarly journals Rate of Tomato yellow leaf curl virus Translocation in the Circulative Transmission Pathway of its Vector, the Whitefly Bemisia tabaci

2001 ◽  
Vol 91 (2) ◽  
pp. 188-196 ◽  
Author(s):  
Murad Ghanim ◽  
Shai Morin ◽  
Henryk Czosnek
Keyword(s):  
Salivary Glands ◽  
Bemisia Tabaci ◽  
Virus Genome ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Hemolymph Sample ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whiteflies (Bemisia tabaci, biotype B) were able to transmit Tomato yellow leaf curl virus (TYLCV) 8 h after they were caged with infected tomato plants. The spread of TYLCV during this latent period was followed in organs thought to be involved in the translocation of the virus in B. tabaci. After increasing acquisition access periods (AAPs) on infected tomato plants, the stylets, the head, the midgut, a hemolymph sample, and the salivary glands dissected from individual insects were subjected to polymerase chain reaction (PCR) without any treatment; the presence of TYLCV was assessed with virus-specific primers. TYLCV DNA was first detected in the head of B. tabaci after a 10-min AAP. The virus was present in the midgut after 40 min and was first detected in the hemolymph after 90 min. TYLCV was found in the salivary glands 5.5 h after it was first detected in the hemolymph. Subjecting the insect organs to immunocapture-PCR showed that the virus capsid protein was in the insect organs at the same time as the virus genome, suggesting that at least some TYLCV translocates as virions. Although females are more efficient as vectors than males, TYLCV was detected in the salivary glands of males and of females after approximately the same AAP.

scholarly journals Comparative Analyses of Tomato yellow leaf curl virus C4 Protein-Interacting Host Proteins in Healthy and Infected Tomato Tissues

2016 ◽  
Vol 32 (5) ◽  
pp. 377-387 ◽  
Author(s):  
Namgyu Kim ◽  
Jinnyun Kim ◽  
Bongjun Bang ◽  
Inyoung Kim ◽  
Hyun-Hee Lee ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Host Proteins ◽  
Comparative Analyses ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Tomato Yellow Leaf Curl Virus-Is Causes a Novel Disease of Common Bean and Severe Epidemics in Tomato in Spain

Plant Disease ◽  
1999 ◽  
Vol 83 (1) ◽  
pp. 29-32 ◽  
Author(s):  
Jesús Navas-Castillo ◽  
Sonia Sánchez-Campos ◽  
Juan Antonio Díaz ◽  
Elisa Sáez-Alonso ◽  
Enrique Moriones
Keyword(s):  
Common Bean ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Fresh Market ◽  
First Report ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Field surveys were conducted in the autumn of 1997 in the main tomato (Lycopersicon esculentum)-growing regions of southern Spain following a severe tomato yellow leaf curl epidemic in tomato. Tomato yellow leaf curl virus (TYLCV)-Is was found to have spread to all regions and to coexist with TYLCV-Sr, which has been present since 1992. TYLCV-Is was also shown to be the causal agent of bean leaf crumple, a novel disease that has caused severe economic losses in fresh-market common bean (Phaseolus vulgaris) crops of southern Spain since September 1997. The disease was reproduced by infecting beans with cloned TYLCV-Is obtained from infected tomato plants collected in Almería. This is the first report of bean leaf crumple disease and the first report of a geminivirus in bean from Spain.

scholarly journals The effect and mechanism of Dufulin in controlling tomato yellow leaf curl virus on tomato plants

2020 ◽  
Author(s):  
Liping Huang ◽  
Shuaixin Wang ◽  
Zhuo Zhang ◽  
Xuguo Zhou ◽  
Zhanhong Zhang ◽  
...  
Keyword(s):  
Chlorophyll Content ◽  
Tomato Yellow Leaf ◽  
Chemical Agent ◽  
Yellow Leaf ◽  
Control Effect ◽  
Tomato Plants ◽  
Significant Difference ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Background: Tomato yellow leaf curl virus (TYLCV) causes critical production loss in tomato cultivation. The control of TYLCV in tomato is done mainly by using pesticide which is difficult and expensive, making it essential to find an environmentally friendly chemical agent to control TYLCV. Dufulin has been widely used to prevent and control viral diseases in tobacco and rice in recent years. In this study, we investigated the effect and mechanism of Dufulin on TYLCV on tomato plants.Methods: The control effect of Dufulin on TYLCV was evaluated by field experiments. The expression level of PI II and NPR1 in healthy and TYLCV-infected tomato after treatments were determined by Real-time fluorescent quantitative PCR (qRT-PCR). Handheld chlorophyll meter was applied to compare the content of chlorophyll and nitrogen in healthy and TYLCV-infected tomato after treatments.Results: It showed that the relative control effect of 20% Dufulin on TYLCV reached above 68% in 2018 to 2020. Jasmonic acid (JA) level was higher on healthy tomato, but lower on TYLCV-infected tomato plants treated with Dufulin compared to control. Salicylic acid (SA) level was higher on healthy and TYLCV-infected tomato plants treated with Dufulin compared to control. Chlorophyll content on healthy and TYLCV-infected tomato plants was higher after treatment with Dufulin compared to control. Nitrogen content on tomato plants showed no significant difference after spraying Dufulin compared to control.Conclusions: We found the first evidence of control effects TYLCV using Dufulin. It induced plant defense and increased plant chlorophyll content to help plants resist infection which is helpful for future control of TYLCV in tomato.

scholarly journals Tomato yellow leaf curl virus in Tomato in Texas, Originating from Transplant Facilities

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 466-466 ◽  
Author(s):  
T. Isakeit ◽  
A. M. Idris ◽  
G. Sunter ◽  
M. C. Black ◽  
J. K. Brown
Keyword(s):  
Rolling Circle Amplification ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Bipartite Begomovirus ◽  
Subtropical Climate ◽  
Yellow Leaf ◽  
Fresh Market ◽  
Hidalgo County ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a monopartite virus in the genus Begomovirus (family, Geminiviridae) from the Middle East, is one of the most damaging whitefly-transmitted viruses of tomato (Lycopersicon esculentum) worldwide. TYLCV was first identified in the United States in 1997 in Florida (4), and most recently, in the Pacific Coast states of Mexico where fresh market tomatoes are grown for the U.S. market (1). During September 2006, tomatoes grown from transplants in Waller County, TX exhibited shortened internodes, stunting and puckering of leaflets, green vein banding, and diffuse chlorosis. The disease incidence in two fields (4 ha total) was 95% and yield was substantially reduced. Many of the transplants were symptomatic at planting. The transplants originated from two facilities in Hidalgo County, TX. Both facilities had experienced heavy infestations of the whitefly, Bemisia tabaci (Genn.), during transplant production. At the same time, transplants produced in Uvalde and Bexar counties, TX, where whitefly infestations were also prevalent, had similar virus symptoms. Total DNA was extracted from the leaves of symptomatic tomato plants from 10 samples from these four counties and amplified by PCR (2). DNA samples from Waller, Hidalgo, and Uvalde counties were cloned, and a partial fragment of the viral coat protein gene (core Cp) was sequenced. BLAST analysis of the core Cp sequences of each sample confirmed the presence of TYLCV. No other begomovirus was detected, and all attempts to amplify a bipartite begomovirus by PCR using degenerate DNA-B specific primers (3) were unsuccessful. The full-length TYLCV DNA was amplified from three samples using the rolling circle amplification method as described (1), cloned, and the sequences were determined. The three sequences shared 99.6 to 100% nt identity and so only one sequence was deposited in the NCBI GenBank database (Accession No. EF110890) (1). Analysis of the complete genome nucleotide sequence corroborated TYLCV identity predicted by core Cp analysis that was 98.1% identical with TYLCV from Egypt (GenBank Accession No. AY594174) and Spain (GenBank Accession No. AJ489258), 97.6% with TYLCV from Mexico (GenBank Accession No. DQ631892), and 96.5% with TYLCV-Is (GenBank Accession No. X15656). Additionally, a Southern blot with TYLCV as the probe detected replicating (double-stranded) TYLCV DNA in all samples consisting of three plants from Uvalde County and 21 plants from Bexar County. To our knowledge, this is the first report of TYLCV in Texas that occurred in two transplant production areas approximately 400 km apart. Transplants produced in Uvalde and Bexar counties were planted there, while Hidalgo County transplants were shipped outside of the usual range of the whitefly. Hidalgo County has a subtropical climate, which can allow overwintering of TYLCV and the whitefly vector, allowing the establishment and spread of this virus in the future. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. K. Brown et al. Arch. Virol. 146:1581, 2001. (3) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (4) J. E. Polston et al. Plant Dis. 83:984, 1999.

scholarly journals Molecular diagnosis of new isolate of tomato yellow leaf curl virus (TYLCV) in Iraq

2021 ◽  
Author(s):  
Ali Alabde ◽  
Osamah N Alisawi ◽  
Fadhal A Al Fadhal
Keyword(s):  
Phylogenetic Analyses ◽  
Complete Sequence ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Molecular Tests ◽  
Tomato Yield ◽  
Close Relationship ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yield and quality in Iraq have been threatened by a variable range of infections caused by tomato yellow leaf curl virus. In previous studies, the TYLCV isolates were partially characterized using molecular tests for small fragments not the entire length of the virus. Sample of TYLCV-infected tomato has applied in this study to diagnose complete sequence of TYLCV isolate. Three sets of primers that belong to three well-identified strains in Iraq were used in a PCR technique and interestingly the results were negative. A new Iraqi isolate has been characterized as a first novel Iraqi isolate detected ever using next generation (NGS) and bioinformatics techniques. The NGS platform has produced about 78,232,062 paired reads of the TYLCV-infected tomato var. Oula F1. The complete raw reads of the infected variety have been analyzed using RepeatExplorer pipeline and Map to reference. The full sequence of TYLCV was reconstructed and extracted to consist of 2770 nt and then deposited in Genbank under accession number MT583814. Copy numbers and genome proportion of this sequence have been calculated that were 3523 and 0,086% respectively. Phylogenetic analyses of full nucleotide sequences confirmed close relationship to Iranian isolate (TYLCV-Kahnooj) than other published viruses. Additionally, a and β DNA satellites have not discovered in the TYLCV-infected sample.

Sign in / Sign up

Export Citation Format

Share Document