scholarly journals First Report of Botrytis Blight Caused by Botrytis cinerea on Sweet Basil in Hungary

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1052-1052
Author(s):  
G. Nagy
Keyword(s):  
Botrytis Cinerea ◽  
Northern Region ◽  
Conidial Suspension ◽  
Large Area ◽  
Field Surveys ◽  
First Report ◽  
Sweet Basil ◽  
Potted Plants ◽  
Plastic Bags ◽  
Disease Occurrence

In Hungary, sweet basil (Ocimum basilicum L.) is an important medicinal and aromatic plant cultivated over a large area. During field surveys conducted in August and September of 2001 and 2002, significant blossom and leaf blight were observed in plant stands located near Budapest and in the northern region of Hungary at Herencsény. Incidence of disease occurrence ranged between 49 and 92%. Abundant grayish-brown mold consisting of mycelia and conidiophores was observed on necrotic flowers and upper leaves. The fungus was identified as Botrytis cinerea Pers.:Fr.. Conidia were one-celled, ovoid to elliptical, and measured 11.2 × 7.4 μm (7.5 to 15.0 × 5.0 to 10.0 μm). The fungus was isolated on Leonian malt media. In culture, small and large irregular sclerotia, as well as conidiophores, were produced abundantly. Size of large sclerotia ranged between 45 and 95 mm. Sclerotia were produced only in culture. Pathogenicity of two isolates originating from Herencsény was confirmed by spraying eight sweet basil potted plants with a conidial suspension (6.3 × 105 conidia/ml) made from a pure culture. Two noninoculated plants served as controls. Half of the plants were wounded with needles to make incisions on the leaves and flower axes prior to the inoculation, while the remaining plants were directly sprayed. After inoculation, plants were kept in plastic bags in a greenhouse to maintain 90 to 100% relative humidity at 15 to 40°C. After 5 days, water-soaked chlorotic lesions appeared on the wounded leaves of the inoculated plants. After day 12, brown necrosis developed on the flowers of all inoculated plants. Flower axes often broke. Sporulation of the fungus was abundant. Wounding contributed to earlier appearance of the symptoms and more intensive disease development. To our knowledge, this is the first report of botrytis blight on sweet basil in Hungary. In Europe, the disease has been observed in Italy (1) and Greece (2). References: (1) A. Garibaldi et al. Plant Dis. 81:124, 1997. (2) C. D. Holevas et al. Benaki Phytopathol. Inst. Kiphissia, Athens 19:1, 2000.

scholarly journals First Report of Botrytis Blight Caused by Botrytis cinerea on Gaura lindheimeri in Italy

Plant Disease ◽  
2009 ◽  
Vol 93 (1) ◽  
pp. 107-107
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
P. Pensa ◽  
M. L. Gullino
Keyword(s):  
Botrytis Cinerea ◽  
Leaf Tissue ◽  
Fluorescent Light ◽  
Pathogenicity Test ◽  
First Report ◽  
Perennial Plant ◽  
Potted Plants ◽  
Plastic Bags ◽  
Pathogenicity Tests ◽  
Basal Portion

Gaura lindheimeri (wand flower) is a perennial plant belonging to the Onagraceae family that is used for perennial borders in xeric and mesic landscapes. It produces flowers floating above the plant like small, dancing butterflies. This plant is becoming popular in the Albenga Region (northern Italy) where white and rose varieties are grown as potted plants. In January of 2008, 5-month-old ‘Whirling Butterflies’ plants grown in plastic pots (14 cm in diameter) in the open field started showing symptoms of a previously unknown blight. When the disease developed, temperatures ranged between 3 and 17°C (average 9°C) and average relative humidity was 64%. Small, brown spots appeared on the basal portion of leaves first, eventually spreading to cover entire leaves. Subsequently, the pathogen developed abundant, soft gray mycelium on affected leaf tissue. Severely infected leaves eventually became completely rotten and desiccated. Sixty percent of plants were affected by the disease. Tissues were excised from diseased leaves, immersed in a solution containing 1% sodium hypochlorite for 10 s, and then cultured on potato dextrose agar (PDA) medium. The fungus produced abundant mycelium on PDA medium when incubated under constant fluorescent light at 22 ± 1°C. The conidia were smooth, hyaline, globoid, measuring 11.8 to 9.4 × 8.3 to 6.6 (average 10.7 × 7.4) μm, and are similar to those described for Botrytis cinerea. The identity of the pathogen was also confirmed by the production of numerous sclerotia on PDA plates incubated for 20 days at 8 ± 1°C. Sclerotia were dark, irregular, and measured 3 to 4 × 2 to 3 mm. The fungus was identified as B. cinerea on the basis of these characters (1). Pathogenicity tests were performed by spraying leaves of healthy, potted 8-month-old G. lindheimeri ‘Whirling Butterflies’ plants with a 105 conidia/ml suspension. Plants sprayed with water only served as controls. Five plants per treatment were used. Plants were covered with plastic bags for 6 days after inoculation and maintained in a growth chamber at 20 ± 1°C. The first foliar lesions developed on leaves 5 days after inoculation, whereas control plants remained healthy. B. cinerea was consistently reisolated from these lesions. The pathogenicity test was completed twice. To our knowledge, this is the first report of the presence of B. cinerea on G. lindheimeri in Italy. The economic importance of this disease will increase with the increased cultivation of this species. Reference: (1) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972.

scholarly journals First Report of Gray Mold of Rhizoma paridis Caused by Botrytis cinerea in China

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1434-1434 ◽  
Author(s):  
J. M. You ◽  
Q. H. Wang ◽  
X. M. Lin ◽  
J. Guo ◽  
L. Q. Ai ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Leading Edge ◽  
Its Region ◽  
Gray Mold ◽  
Pathogenicity Test ◽  
Heat Shock Protein 60 ◽  
Chinese Medicinal Herb ◽  
First Report ◽  
Potted Plants ◽  
Plastic Bags

Rhizoma paridis is a perennial, traditional Chinese medicinal herb. In May 2013, a disease was observed in an approximately 10 ha cultivated field in Enshi, Hubei Province, China. Approximately 80% of plants in the field were affected. Symptoms were visible on the basal leaves of affected plants. Chlorosis followed by necrosis started at the leaf tips and margins and gradually spread inward until the entire leaf was necrotic. Thick, gray mycelium and conidia were visible on both sides surface of leaves under wet, humid conditions. The leading edge of the chlorotic leaves was excised from 20 plant samples surface disinfested with 1% NaOCl solution for 1 min, rinsed in sterile water, air dried, and placed on potato dextrose agar (PDA). Plates were incubated at 22°C in the dark. Mycelia were initially hyaline and white, and became dark gray after 72 h. Mycelia were septate with dark branched conidiophores. Conidia were smooth, hyaline, ovoid, aseptate, and ranged from 8 to 14.5 × 7 to 8.5 μm. Numerous hard, small, irregular, and black sclerotia that were 1 to 3 × 2 to 5 mm were visible on PDA plates after 12 days. The fungus was identified as Botrytis cinerea on the basis of these characters (1). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1 and ITS4 primer and sequenced (GenBank Accession No. KF265499). BLAST analysis of the PCR product showed 99% identity to Botryotinia fuckeliana (perfect stage of B. cinerea) (EF207415.1, EF207414.1). The pathogen was further identified to the species level as B. cinerea using gene sequences from glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) (2) (KJ638600, KJ638602, and KJ638601). Pathogenicity was tested by spraying the foliage of 40 two-year-old plants with a suspension of 106 conidia per ml of sterile distilled water. Each plant received 30 ml of the inoculum. Ten healthy potted plants were inoculated with sterilized water as control. All plants were covered with plastic bags for 5 days after inoculation to maintain high relative humidity and were placed in a growth chamber at 22°C. The first foliar lesions developed on leaves 7 days after inoculation and were similar to those observed in the field. No symptoms developed on the control plants. B. cinerea was consistently re-isolated from all artificially inoculated plants. The pathogenicity test was completed twice. To our knowledge, this is the first report of gray mold of R. paridis caused by B. cinerea in China. The root of R. paridis is the most commonly used Chinese herbal medicine to treat viper bites. In recent years, cultivation of this herb has increased in China because of its high value. Consequently, the economic importance of this disease is likely to increase with the greater prevalence of this host species. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

scholarly journals First Report of Botrytis Blight Caused by Botrytis cinerea on Lavandula stoechas in Italy

Plant Disease ◽  
2010 ◽  
Vol 94 (3) ◽  
pp. 380-380 ◽  
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
P. Pensa ◽  
M. L. Gullino
Keyword(s):  
Botrytis Cinerea ◽  
Its Region ◽  
Northern Italy ◽  
Fluorescent Light ◽  
Pathogenicity Test ◽  
Commonwealth Mycological Institute ◽  
First Report ◽  
Potted Plants ◽  
Lavandula Stoechas ◽  
Plastic Bags

Lavandula stoechas or French lavender (Labiatae) is a perennial shrub that produces pinkish purple flowers and is endemic to the Mediterranean Region. In the Albenga area (northern Italy), this species is grown as a potted plant. In October 2008, symptoms of a previously unknown blight were observed in a commercial glasshouse in the Savona Province (northern Italy) on 10% of 3-month-old ‘Sugarberry Ruffles’ potted plants. Glasshouse temperatures ranged between 11 and 32°C (average of 21°C) and plants were overhead irrigated. Initially, leaves and stems appeared chlorotic. Subsequently, necrotic lesions developed on infected tissues. After 10 days, fluffy, gray mycelium became apparent on symptomatic tissue, especially on the basal parts of the plants. Severely infected plants eventually died. Tissues were excised from diseased leaves, immersed in an aqueous solution of 1% sodium hypochlorite for 10 s, and then cultured on potato dextrose agar (PDA). A fungus developed abundant mycelium when incubated under constant fluorescent light at 22 ± 1°C. Numerous small sclerotia developed on PDA plates incubated for 20 days at 8 ± 1°C. Sclerotia were dark and irregular and measured 2 to 5 × 1 to 2 mm. Conidia were smooth, gray, unicellular, ovoid, measured 9.4 to 13.6 × 6.2 to 7.9 (average 11.4 × 7.2) μm, and similar to those described for Botrytis cinerea (2). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS4/ITS6 and sequenced. BLAST analysis (1) of the 573-bp segment was 100% similar to the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). The nucleotide sequence has been assigned GenBank Accession No. GQ375747. Pathogenicity tests were performed by spraying leaves of 9-month-old healthy potted L. stoechas ‘Blue Star’, ‘Madrid Blue’, ‘Madrid Purple’, and ‘Madrid White’ plants with a 7.5 × 104 conidia/ml spore suspension obtained from 7-day-old PDA cultures. Each plant received 5 ml of inoculum. Plants sprayed with water only served as controls. Four plants per treatment and per cultivar were used. Plants were covered with plastic bags for 4 days after inoculation and maintained in a growth chamber at 20 ± 1°C. The first lesions developed on flowers 5 days after inoculation, and 2 days later, lesions developed on leaves and stems. Lesions were similar to those observed in the commercial glasshouse. Control plants remained healthy. B. cinerea was consistently reisolated from these lesions. The pathogenicity test was completed twice. To our knowledge, this is the first report of the presence of B. cinerea on L. stoechas in Italy as well as worldwide. Botrytis blight previously has been described on L. angustifolia in Japan (4) and Poland (3). In Italy, the economic importance of the disease is currently still limited. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, 1971. (3) L. B. Orlikowski and A. Valjiuskaite. Acta Mycol, 42:193, 2007. (4) J. Takeuch and H. Horie. Annu. Rep. Kanto-Tosan Plant Prot. Soc. 53:87, 2006.

scholarly journals First Report of Botrytis Blight Caused by Botrytis cinerea on Chamelaucium uncinatum in Italy

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 968-968 ◽  
Author(s):  
A. Garibaldi ◽  
D. Bertetti ◽  
F. Tinivella ◽  
M. L. Gullino
Keyword(s):  
Botrytis Cinerea ◽  
Its Region ◽  
Northern Italy ◽  
Fluorescent Light ◽  
Pathogenicity Test ◽  
Commonwealth Mycological Institute ◽  
First Report ◽  
Potted Plants ◽  
Plastic Bags ◽  
Chamelaucium Uncinatum

Chamelaucium uncinatum (wax flower), an evergreen shrub belonging to the Myrtaceae family, is suitable for growing in containers. In the Albenga area (northern Italy), this species is grown as a potted plant. In April 2009, symptoms of a previously unknown blight were observed in a commercial glasshouse in the Savona Province (northern Italy) on 80% of 500 potted plants of cv. Snow Flake. Glasshouse temperatures ranged between 16 and 22°C and plants were drip irrigated. Initially, leaves and calyces appeared chlorotic. Subsequently, necrotic lesions developed on flower stalks and occasionally the corollas. After 10 days, soft, gray mycelium became apparent on symptomatic tissue, especially on the foliage. Severely infected leaves and flowers eventually became completely necrotic and abscised. Tissues were excised from diseased leaves, immersed in a solution containing 1% sodium hypochlorite for 10 s, and then cultured on potato dextrose agar (PDA) medium. A fungus developed abundant mycelium when incubated under constant fluorescent light at 23 ± 1°C. Numerous, small sclerotia also developed on PDA plates incubated for 20 days at 8 ± 1°C. Sclerotia were dark, spheroid, and measured 0.5 to 1.8 × 0.5 to 1.5 (average 1.2 × 1.0) mm. Conidia were smooth, gray, unicellular, ovoid, measured 8.5 to 11.1 × 7.1 to 8.6 (average 9.7 × 7.8) μm, and similar to those described for Botrytis cinerea (2). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLAST analysis (1) of the 495-bp segment showed 100% similarity with the sequence of Botryotinia fuckeliana (perfect stage of B. cinerea). The nucleotide sequence has been assigned the GenBank Accession No. GQ149477. Pathogenicity tests were performed by spraying leaves of healthy potted C. uncinatum with a spore suspension (2 × 104 conidia/ml) obtained from PDA cultures of the pathogen. Each plant received 30 ml of the inoculum. Plants sprayed with water only served as controls. Three plants per treatment were used. Plants were covered with plastic bags for 5 days after inoculation and maintained in a growth chamber at 20 ± 1°C. The first foliar lesions developed on leaves 7 days after inoculation and were similar to those observed in the commercial glasshouse, whereas control plants remained healthy. B. cinerea was consistently reisolated from these lesions. The pathogenicity test was completed twice. To our knowledge, this is the first report of the presence of B. cinerea on C. uncinatum in Italy as well as in Europe. The disease has been reported in California (3) and more recently in South Africa (4). In Italy, the economic importance of the disease is currently still limited. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, England, 1971. (3) A. M. French. California Plant Disease Host Index. Calif. Dep. Food Agric., Sacramento, 1989. (4) L. Swart and S. Coertze. Plant Dis. 86:440, 2002.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of the Pathogenicity of Colletotrichum gloeosporioides on Invasive Ferns, Lygodium microphyllum and L. japonicum, in Florida

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 101-101 ◽  
Author(s):  
K. A. Jones ◽  
M. B. Rayamajhi ◽  
P. D. Pratt ◽  
T. K. Van
Keyword(s):  
Colletotrichum Gloeosporioides ◽  
First Record ◽  
South Florida ◽  
Growth Chamber ◽  
Fluorescent Light ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Potted Plants ◽  
Plastic Bags ◽  
Fern Species

Lygodium microphyllum (Cav.) R.Br. (Old World climbing fern) and L. japonicum (Thunb.) Sw. (Japanese climbing fern), in the family Schizaeaceae, are among the most invasive weeds in Florida (1). L. microphyllum invades fresh water and moist habitats in south Florida, while L. japonicum has spread in relatively well-drained habitats from Texas to North Carolina and central Florida. Some potted plants of both Lygodium spp. grown in shadehouse as well as in full sunlight developed discolored spots on pinnules (foliage), which coalesced and resulted in browning and dieback of severely infected vines. Symptomatic foliage obtained from these plants was surface-sterilized by immersing in a 15% solution of commercial bleach for 90 s, followed by a series of four rinses with sterile deionized distilled water. Disks (4 mm in diameter) of pinnules were cut from the junction of discolored and healthy tissues and placed on potato dextrose agar (PDA). A fungus, Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. was consistently isolated from these disks. Fungal colonies produced abundant conidia on PDA. Conidia were hyaline, straight, cylindrical, averaging 14.7 μm (range 12.5 to 17.5 μm) × 5.0 μm (range 3.8 to 7.5 μm), and similar to those described for C. gloeosporioides (2). To confirm the pathogenicity of C. gloeosporioides on L. microphyllum and L. japonicum, Koch's postulates were performed. A fungal isolate was grown on PDA for 3 weeks, after which 10 ml of sterile deionized distilled water was added to the culture and agitated to dislodge conidia. The conidial suspension was strained through three layers of cheesecloth to remove hyphal fragments, and its concentration was adjusted to 1.7 × 106 conidia/ml. Foliage of healthy L. microphyllum and L. japonicum plants grown in 500-ml containers was sprayed with the conidial suspension until runoff. Plants were covered with plastic bags whose inner sides were misted with water to maintain high humidity and placed in a growth chamber under 12 h of fluorescent light per day. Temperature and relative humidity in the chamber ranged from 26 to 29°C and 44 to 73%, respectively. Plastic bags were removed after 3 days, and plants were further incubated for 3 weeks in the same growth chamber. Control plants were sprayed with sterile water, covered with plastic bags, and exposed to the same temperature, light, and humidity regime as those of the fungus-inoculated plants. Small, discolored foliar spots appeared 3 days after fungus inoculation. These spots were similar to those observed on pinnules of potted plants that originated from shadehouse and outdoor environments. Within 3 weeks after inoculation, the foliage of L. japonicum developed abundant discolored spots that led to edge browning and wilting of the pinnules. L. microphyllum had similar but more severe symptoms, with plants suffering as much as 50% dieback. C. gloeosporioides was consistently reisolated from the symptomatic tissues of both fern species. No symptoms appeared on the water-inoculated plants. To our knowledge, this is the first record of C. gloeosporioides pathogenicity on L. microphyllum and L. japonicum. References: (1) R. W. Pemberton and A. P. Ferriter. Am. Fern J. 88:165, 1998. (2) B. C. Sutton. Colletotrichum: Biology, Pathology and Control. CAB International, Wallingford, Oxon, UK, 1992.

scholarly journals The First Report of Downy Mildew Caused by Peronospora belbahrii on Sweet Basil in Greenhouses in the Czech Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1579-1579 ◽  
Author(s):  
I. Šafránková ◽  
L. Holková
Keyword(s):  
Czech Republic ◽  
Downy Mildew ◽  
Width Ratio ◽  
Specific Sequence ◽  
The Czech Republic ◽  
First Report ◽  
Sweet Basil ◽  
Potted Plants ◽  
Length Width ◽  
Necrotic Spots

Sweet basil (Ocimum basilicum L.) is an aromatic plant that is cultivated as a pot plant in greenhouses or in fields in the Czech Republic. The plants are intended for direct consumption or for drying. In April of 2012, the first large chlorotic from the middle necrotic spots occurred gradually on leaves of pot plants O. basilicum cv. Genovese in greenhouses in Central Bohemia. The characteristic gray to brown furry growth of downy mildew appeared on abaxial surfaces of leaves in the place of chlorotic spots within 3 to 4 days. The infested leaves fell off in the late stages of pathogenesis. The infestation gradually manifested itself in ever-younger plants and in July, cotyledons and possibly the first true leaves were already heavily infected and damaged and these plants rapidly died. The plant damage reached 80 to 100%, so it was necessary to stop growing the plants in the greenhouse at the end of July. The causal agent was isolated and identified as Peronospora belbahrii Thines by means of morphological and molecular characters (2,3). Conidiophores were hyaline, straight, monopodial, 280 to 460 μm, branched three to five times, ended with two slightly curved branchlets with a single conidia on each branchled tip. The longer branchlets measured 13 to 24 μm (average 18.2 μm), the shorter one 4 to 15 μm (average 9.7 μm). Conidia were rounded or slightly ovoid, from brownish to dark brownish, measured 22 to 31 × 20 to 28 μm (length/width ratio 1.2). A pathogen-specific sequence was detected with the help of the pathogen ITS rDNA specific primers in symptomatic leaves (1). DNA from plant tissues was isolated using the DNeasy plant Mini Kit (Qiagen, Germany) following the standard protocol. PCR was performed using KAPA2G Robust HotStar kit (Kapa Biosystems, United States) according to the conditions recommended in Belbahri et al. (1). The specific products were visualized by electrophoresis through 1.5% agarose gels. Leaves of 20-day-old potted plants O. basilicum ‘Genovese’ were inoculated by spraying with 5 × 105 conidia/ml of the pathogen. Each pot contained 10 plants. Sterilized distilled water was applied to control plants. Plants were covered with polyethylene bags during the entire incubation period to maintain high humidity, and kept at a temperature of 22 to 24°C. Typical disease symptoms appeared on leaves 5 to 9 days after inoculation. Control plants were symptomless. P. belbahrii was re-isolated from the lesions of inoculated plants, thus fulfilling Koch's postulates. Downy mildew on sweet basil was reported in countries in Africa, Europe, and South and North America (4). To our knowledge, this is the first report of downy mildew on sweet basil in the Czech Republic. References: (1) L. Belbahri et al. Mycol. Res. 109:1276, 2005. (2) Y.-J. Choi et al. Mycol. Res. 113:1340, 2009. (3) M. Thines et al. Mycol. Res. 113:532, 2009. (4) C. A. Wyenandt et al. HortScience 45:1416, 2010.

scholarly journals First Report of Fusarium Wilt on Eremophila spp. Caused by Fusarium oxysporum in Italy

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1509-1509 ◽  
Author(s):  
G. Polizzi ◽  
D. Aiello ◽  
V. Guarnaccia ◽  
A. Vitale ◽  
G. Perrone ◽  
...  
Keyword(s):  
Fusarium Oxysporum ◽  
Morphological Characteristics ◽  
Gene Sequences ◽  
Single Spore ◽  
First Report ◽  
Potted Plants ◽  
Plastic Bags ◽  
Gene Coding ◽  
Affected Plant ◽  
Tubulin Protein

Eremophila spp. (Myoporaceae family), endemic to Australia, are evergreen shrubs or small trees occurring in arid, semi-arid, tropical, or temperate regions. In Europe, Eremophila spp. are grown for their horticultural appeal. During 2009 and 2010, extensive wilting was observed on 2-month to 1-year-old potted plants of Eremophila laanii F. Muell., E. glabra subsp. carnosa Chinnock, and E. maculata (Ker Gawl.) F. Muell. grown in a commercial nursery near Catania (southern Italy). Internally, symptomatic plants had conspicuous vascular discoloration from the crown to the canopy. Diseased crown and stem tissues were surface disinfested for 30 s in 1% NaOCl, rinsed in sterile water, plated on potato dextrose agar (PDA) amended with 100 mg/liter of streptomycin sulfate, and incubated at 25°C. A Fusarium sp. was consistently isolated from affected plant tissues. Colonies with purple mycelia and violet reverse colors developed after 9 days. On carnation leaf agar, single-spore isolates produced microconidia on short monophialides, macroconidia that were three to five septate with a pedicellate base, and solitary and double-celled or aggregated chlamydospores. A PCR assay was conducted on two representative isolates (ITEM 12591 and ITEM 12592) by analyzing sequences of the partial CaM gene (coding calmodulin protein) and benA (coding beta-tubulin protein) using the primers as reported by O'Donnell et al. (1). Calmodulin sequences of ITEM 12951 and ITEM 12952 isolates (GenBank Nos. FR671157 and FR671158) exhibited 99.8 and 99.5% identity with Fusarium oxysporum strain ITEM 2367 (GenBank No. AJ560774), respectively, and had 99.5% homology between them. BenA gene sequences of ITEM 12951 (GenBank No. FR671426) exhibited an identity of 100% to F. oxysporum f. sp. vasinfectum strain CC-612-3 (GenBank No. AY714092.1), and benA gene sequences of ITEM 12952 (GenBank No. FR671427) exhibited an identity of 100% to F. oxysporum f. sp. vasinfectum strain LA 140 (GenBank No. FJ466740.1), whereas the homology between the two strains is 99.5%. Morphological characteristics, as well as CaM and benA sequences, identified the isolates as F. oxysporum Schlechtend:Fr. Pathogenicity tests were performed by placing 1-cm2 plugs of PDA from 9-day-old mycelial cultures near the crown on potted, healthy, 3-month-old cuttings of E. laanii, E. glabra subsp. carnosa, and E. maculata. Twenty plants for each species were inoculated with each isolate. The same number of plants served as noninoculated controls. All plants were enclosed for 4 days in plastic bags and placed in a growth chamber at 24 ± 1°C. Plants were then moved to a greenhouse where temperatures ranged from 23 to 27°C. Symptoms identical to those observed in the nursery developed 20 days after inoculation with both strains. Crown and stem discoloration was detected in all inoculated plants after 45 days. Wilting was detected on 15% of plants. Control plants remained symptomless. F. oxysporum was consistently reisolated from symptomatic tissues and identified as previously above. To our knowledge, this is the first report of F. oxysporum causing disease of Eremophila spp. worldwide. Reference: (1) K. O'Donnell et al. Mycoscience 41:61, 2000.

scholarly journals First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Hunan Province ◽  
Conidial Suspension ◽  
Heat Shock Protein 60 ◽  
Basal Cells ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

scholarly journals First Report of Stem Blight Caused by Botrytis cinerea on Jasminum officinalis in Italy

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708
Author(s):  
D. Aiello ◽  
G. Parlavecchio ◽  
A. Vitale ◽  
G. Polizzi
Keyword(s):  
Botrytis Cinerea ◽  
Far East ◽  
Weather Conditions ◽  
Economic Loss ◽  
Transparent Plastic ◽  
Disease Symptoms ◽  
First Report ◽  
Stem Blight ◽  
Plastic Bags ◽  
Stem Lesions

Common jasmine (Jasminum officinalis L.) is an evergreen shrub that is native to the Middle and Far East. It is widely grown in Europe as an ornamental plant and in southeastern France for fragrance for the perfume industry. In March of 2008, a previously undescribed disease was observed on potted (6-month- to 3-year-old) common jasmine plants growing in open fields in a nursery of eastern Sicily, Italy. More than 20% of the plants showed disease symptoms. Diseased plants had small to large, brown or black lesions on stem. The lesions expanded rapidly, girdled the stem and caused blight of entire branches, and occasionally killed the plant. Abundant conidia and mycelia were detected on the surface of dead and dying stems under cool and humid conditions, which resulted in a moldy gray appearance. Botrytis cinerea Pers.:Fr. (1) was consistently isolated from affected tissues disinfected for 1 min in 1% NaOCl, rinsed in sterile water, and plated on potato dextrose agar (PDA). Colonies were at first white then became gray after 6 to 7 days when spores differentiated. White sclerotia developed after 8 to 9 days and turned black with age. Size of the conidia produced on 1-month-old culture ranged from 5.0 to 9.5 × 6.5 to 12.5 μm on the basis of 50 spore measurements. Sclerotia were spherical or irregular and ranged from 1.0 to 2.5 × 0.9 to 2.9 mm (average 1.7 × 1.8 mm). Stems of eight 6-month-old common jasmine plants were lightly wounded with a sterile razor and inoculated with 3-mm-diameter plugs of PDA from 10-day-old mycelial cultures, eight similar plants were inoculated with mycelium without wounding, and an equal number of noninoculated plants inoculated with only PDA plugs served as control. After inoculation, plants were enclosed in transparent plastic bags at 20 ± 2°C for 5 days. Stem lesions identical to the ones observed in the nursery were detected on all wounded and on two nonwounded fungus-inoculated plants within 5 to 7 days. Control plants remained healthy. B. cinerea was reisolated from typical lesions. The unusually cool and humid weather conditions recorded in Sicily are supposed to be highly conducive of disease outbreak. Although B. cinerea does not usually kill the plants, under these environmental conditions this disease can cause significant economic loss to ornamental nurseries. To our knowledge, this is the first report of B. cinerea causing stem blight on J. officinalis. Reference: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CAB, Kew, Surrey, England, 1971.

Sign in / Sign up

Export Citation Format

Share Document