scholarly journals First Report of Tomato Yellow Leaf Curl Virus-Is in Spain: Coexistence of Two Different Geminiviruses in the Same Epidemic Outbreak

Plant Disease ◽  
1997 ◽  
Vol 81 (12) ◽  
pp. 1461-1461 ◽  
Author(s):  
J. Navas-Castillo ◽  
S. Sánchez-Campos ◽  
J. A. Díaz ◽  
E. Sáez-Alonso ◽  
E. Moriones
Keyword(s):  
Direct Sequencing ◽  
Nucleotide Sequences ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Western Mediterranean Basin ◽  
Two Samples ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl

Epidemics of tomato yellow leaf curl have occurred annually in greenhouse- and field-grown tomato (Lycopersicon esculentum Mill.) crops in southern Spain since 1992 (2). The nucleotide sequences of two tomato yellow leaf curl virus (TYLCV) isolates from this region, TYLCV-M (GenBank accession no. Z25751) and TYLCV-Alm (L27708), have been determined and these isolates are closely related to isolates reported from Italy (X61153 and Z28390), suggesting the existence of a geographical cluster of closely related TYLCV isolates in the Western Mediterranean Basin (2). In June 1997, new and unusually severe symptoms of stunting, yellowing, and curling of leaflet margins, with a marked reduction in leaf size, were observed in some plants of a greenhouse-grown tomato crop in Almeria (southeastern Spain). Tomato plants showing milder symptoms similar to those previously described for TYLCV infection in that region (2) were also present in the same greenhouse. Total nucleic acids extracts from plants exhibiting both types of symptoms were analyzed by dot blot hybridization with a probe prepared by random priming on a 1,674-bp SalI fragment of the pSP95 clone of TYLCV-M (3). A strong reaction was obtained with the samples that showed mild symptoms, whereas a weak reaction was observed with the severely affected plants. Specific pairs of primers were prepared to amplify the complete pre-coat (V1) (MA10: 5′-ATGTGGGATCCTTTATTAAATG-3′; MA11: 5′-TCAGGGCTTCTGTACATTC-3′) and C2 (MA12: 5′-TAAAGACTCTTAAAAAATGACC-3′; MA13: 5′-AATGCAATCTTCGTCACC-3′) genes based on TYLCV-M sequence. With polymerase chain reaction (PCR), the expected fragments were amplified from extracts of both types of plants. The PCR products were submitted to single-strand conformation polymorphism (SSCP) analysis. Clearly distinguishable SSCP patterns were obtained: one for the plants with mild symptoms, identical to that of known TYLCV-M infected plants, and another for the plants with more severe symptoms. Further analyses done on tomato samples collected from the same area showed that both SSCP patterns were present simultaneously in several severely affected plants. The nucleotide sequences of the V1 and C2 PCR products from two samples differing in their SSCP pattern were obtained by direct sequencing, and compared with available TYLCV sequences. The sequences corresponding to the sample with mild symptoms were 100% identical to those previously reported for TYLCV-M. In contrast, the sequences from the sample that showed severe symptoms (GenBank accesion no. AF022219 for V1, and AF022220 for C2) were only 80 and 76% identical to TYLCV-M V1 and C2 genes, respectively, but were 99% identical to the sequence reported for an isolate of TYLCV-Is from Israel (X15656). Epidemics in tomato caused by TYLCV-Is have been recently reported from Portugal (1). Our results demonstrate that the unusually severe symptoms observed are associated with an isolate of TYLCV-Is that coexists in the field with the milder TYLCV previously reported from this area. This is the first report of the occurence of TYLCV-Is in Spain. References: (1) D. Louro et al. Plant Dis. 80:1079, 1996. (2) E. Noris et al. Arch. Virol. 135:165, 1994.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals Spread of Tomato yellow leaf curl virus Sar from the Mediterranean Basin: Presence in the Canary Islands and Morocco

Plant Disease ◽  
2000 ◽  
Vol 84 (4) ◽  
pp. 490-490 ◽  
Author(s):  
F. Monci ◽  
J. Navas-Castillo ◽  
J. L. Cenis ◽  
A. Lacasa ◽  
A. Benazoun ◽  
...  
Keyword(s):  
Canary Islands ◽  
Sequence Data ◽  
Random Amplified Polymorphic Dna ◽  
Nucleotide Sequences ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gran Canaria ◽  
Two Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Severe outbreaks of tomato yellow leaf curl disease occurred during summer and autumn 1999 in tomato (Lycopersicon esculentum Mill.) crops in the Vecindario Region of Gran Canaria (Canary Islands, Spain) and Agadir (southwestern Atlantic coast of Morocco). Symptoms of the disease included upward curling of leaflet margins, reduction of leaflet area, and yellowing of young leaves, as well as stunting and flower abortion. High populations of whiteflies, Bemisia tabaci Gen., were present on tomatoes in Agadir, and analysis of adult individuals by random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) identified them as the biotype Q. Samples were collected from symptomatic tomato plants: 5 plants from Gran Canaria and 22 from three areas in Agadir, (7 from Agadir/1, 12 from Agadir/2, and 3 from Agadir/3) in the Koudya Region. Samples were analyzed for Tomato yellow leaf curl virus (TYLCV) Sar or Is (genus Begomovirus, family Geminiviridae) infection by squash blot hybridization under high stringency conditions with digoxigenin-labeled DNA probes specific to TYLCV-Sar or -Is, as described previously (1,3). The TYLCV-Sar probe hybridized to the five samples from Gran Canaria, and the TYLCV-Is probe hybridized to the 22 samples from Agadir. The TYLCV-Sar probe also hybridized to the three samples from Agadir/3. Primer pairs MA-14/MA-15 and MA-30/MA-31, designed for specific amplification of the intergenic region (IR) of TYLCV-Sar or -Is reported from Spain, respectively (1), were used in PCR to amplify one sample each from Gran Canaria, Agadir/1, and Agadir/3. A fragment of the expected size was obtained from the samples from Gran Canaria and Agadir/3 using MA14/MA15 (342 bp) and from the two samples from Agadir using MA30/MA31 (357 bp). PCR products were directly sequenced (GenBank Accession nos. AF215819 to AF215822). The nucleotide sequences of the IR fragments amplified from the Gran Canaria and Agadir/3 sample using MA-14/MA-15 indicated their closest relationship (99.0 and 96.7% identity, respectively) was to the corresponding region of a TYLCV-Sar isolate reported from Spain (GenBank Accession no. L27708). The nucleotide sequences of the IR fragments amplified from the Agadir/1 and Agadir/3 samples using MA-30/MA-31 indicated their closest relationship (98.1% identity) was to the corresponding region of the TYLCV-Is isolate reported from Spain (GenBank Accession no. AF071228). Based on the hybridization and sequence data, we conclude that the symptomatic plants from Gran Canaria were infected by TYLCV-Sar, those from Agadir/1 and Agadir/2 were infected by TYLCV-Is, and those from Agadir/3 had mixed infections with TYLCV-Is and TYLCV-Sar. The presence of TYLCV-Is in Morocco has been described recently (2). However, this is the first report of TYLCV-Sar in the Canary Islands and Morocco and extends its geographic range beyond the Iberian Peninsula and Italy. References: (1) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (2) M. Peterschmitt et al. Plant Dis. 83:1074, 1999. (3) S. Sánchez-Campos et al. Phytopathology 89:1038, 1999.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Cowpea in China

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 362-362 ◽  
Author(s):  
F. M. Dai ◽  
R. Zeng ◽  
W. J. Chen ◽  
J. P. Lu
Keyword(s):  
Tomato Yellow Leaf ◽  
Insect Vector ◽  
Yellow Leaf ◽  
First Report ◽  
Cp Gene ◽  
Large Populations ◽  
Pcr Products ◽  
Viral Coat ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (1). In China, this virus was first found in 2006 on tomato in Shanghai (2). In October 2008, chlorotic yellow leaves of cowpea (Vigna sinensis) were observed in Qingpu, Shanghai, China with 15 to 20% incidence in plants in high tunnels. Large populations of whiteflies were observed in association with the diseased cowpea. The disease agent was transmitted to cowpea (and tomato) by whiteflies, which resulted in chlorotic yellow leaves on cowpea (yellow leaf curl symptoms on tomato) that were identical to those observed in the field. On the basis of the suspected insect vector, symptomology, and severe epidemics of tomato yellow leaf curl disease (TYLCD) in Shanghai in recent years, Tomato yellow leaf curl virus was suspected as the causal agent. Total DNA was extracted from four symptomatic cowpea samples. PCR was performed with specific primers V416 (5′-CAAGGCACAAACAAGCGACG-3′) and C1287 (5′-CTCAACTTCCGAATTTGGACGAC-3′) to amplify a 872-bp DNA fragment of the viral coat protein (CP) gene and an amplicon of the expected size was obtained in all four samples but not from healthy leaf samples. The PCR products were sequenced and the sequences were identical among samples. Primers TYLCV-F (5′-CAGGAGGCAGCCAAGTATGAG-3′) and TYLCV-R (5′-ACTAATGCCTGTTCYTTCATTCC-3′) (Y = C or T/U) were designed on the basis of the sequence (Accession No. HM804856) and reported (Accession No. FM163463) CP gene to amplify the full-length viral DNA of cowpea isolate (CN:SH:Cowpea:08). The sequence was determined to be 2,781 nucleotides long (Accession No. GU434143). A comparison of the sequence with those in GenBank shows that the cowpea isolate has the highest nucleotide sequence identity (99%) with TYLCV isolate XH2 from tomato in Xinghua, Jiangsu, China (Accession No. GU111505). To our knowledge, this is the first report of TYLCV infecting cowpea in China and also the first report in the world. References: (1) H. Czosnek and H. Laterrot. Arch. Virol. 142:1391, 1997. (2) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First report of natural infection of tomato yellow leaf curl virus on cucumber in China

2020 ◽  
Vol 102 (4) ◽  
pp. 1371-1371
Author(s):  
Feng Zhu ◽  
Qin-Qin Zhang ◽  
Peng-Xiang Zhu ◽  
Qi-Ping Zhang ◽  
Meng-Yao Cao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Occurrence of Tomato yellow leaf curl virus in Tomato in Martinique, Lesser Antilles

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1058-1058 ◽  
Author(s):  
C. Urbino ◽  
A. Dalmon
Keyword(s):  
Pcr Primers ◽  
Tomato Yellow Leaf ◽  
Lesser Antilles ◽  
Yellow Leaf ◽  
Rapid Spread ◽  
Pcr Products ◽  
Dnaman Software ◽  
Northwest Region ◽  
Leaf Curl Virus ◽  
Leaf Curl

During April of 2002, symptoms of stunting and chlorotic curled leaves of reduced size, similar to those caused by Tomato yellow leaf curl virus (TYLCV), were observed for the first time in commercial tomato (Solanum lycopersicum) in the northwest region of Martinique. Six months later, many tomato fields had more than 80% of plants expressing these symptoms and yield was drastically reduced. Samples from two symptomatic plants were collected and analyzed by PCR. Primers PC1 (5′-TGACTATGTCGAAGCGACCAGG-3′) and PC2 (5′-CGACATTACAGCCTCAGACTGG-3′) were used to amplify a 950-bp fragment within the coat protein gene (CP) of TYLCV species (1). Primer pair MP16-MP82 (2) amplified a 550-bp fragment from the conserved nonanucleotide sequence (TAATATTAC) to the 5′ end of the CP gene. Products of expected sizes were obtained with both pairs of primers from symptomatic samples but not from uninfected ones. The two overlapping PCR products were cloned into a pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. A BLAST analysis was conducted with begomovirus sequences available in the GenBank database at the NCBI, and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The 1275-bp sequence (GenBank Accession No. EF490995) shared 99% nucleotide identity with the partial sequences of TYLCV from Antigua and Barbuda (GenBank Accession No. EF028240), Saint Kitts and Nevis (GenBank Accession No. EF028239), and the two overlapping sequences from Guadeloupe (GenBank Accessions No. AY319645 and AY319646). It was at least 98% identical to TYLCV isolates from Florida (GenBank Accession No AY530931), Dominican Republic (GenBank Accession No. AF024715), and Cuba (GenBank Accession No. AJ223505). These results confirm the introduction of TYLCV into Martinique, possibly from a nearby Caribbean country, and reveal its southward spread in the Lesser Antilles. The nearness of the islands in the Lesser Antilles (20 to 100 km distant) probably permitted the rapid spread of TYLCV through the movement of plant material or wind transport of viruliferous whiteflies from one island to the next. Monitoring the spread of TYLCV in this Caribbean archipelago is important for regional virus management and in forecasting the spread of TYLCV to nearby countries in South America. References: (1) Y. Martinez et al. Rev. Prot. Veg. 18:168, 2003. (2) P. Umaharan et al. Phytopathology 88:1262, 1998.

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

scholarly journals First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 428-428 ◽  
Author(s):  
F. Haj Ahmad ◽  
W. Odeh ◽  
G. Anfoka
Keyword(s):  
Tomato Yellow Leaf ◽  
Virus Species ◽  
Yellow Leaf ◽  
First Report ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Symptomatic Plant ◽  
Mexican Isolate ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.

scholarly journals Recent Emergence of the Mild Strain of Tomato yellow leaf curl virus as a Cause of Tomato Yellow Leaf Curl Disease of Processing Tomatoes (Solanum lycopersicon) in the Dominican Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1592-1592 ◽  
Author(s):  
T. Kon ◽  
T. Melgarejo ◽  
A. Almanzar ◽  
R. L. Gilbertson
Keyword(s):  
Dominican Republic ◽  
Australasian Plant ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Mild Strain ◽  
Recent Emergence ◽  
Two Samples ◽  
Leaf Curl Virus ◽  
Processing Tomatoes ◽  
Leaf Curl

In the early 1990s, the monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) was introduced into the Dominican Republic (DO), and molecular characterization revealed it was an isolate of TYLCV-Israel (TYLCV-IL[DO]) (3,5). In 2006, a study of the variability of TYLCV in DO revealed that TYLCV-IL[DO] was associated with all samples of tomato yellow leaf curl (TYLC) tested and, thus, that the virus had been genetically stable for >15 years (2). However, in 2010 and 2011, 2 of 10 and 11 of 18 samples of TYLC, respectively, were negative for TYLCV infection based upon PCR with the TYLCV-specific primer pair, 2560v (5′-GAGAACAATTGGGATATG-3′)/1480c (5′-AATCATGGATTCACGCAC-3′), which directs the amplification of a ~1.7 kb fragment. In 2011, two such samples from the Azua Valley were tested by PCR with the 1470v (5′-AGTGATGAGTTCCCCTGTGC-3′)/UPC2 primer pair (1), and sequence analysis of the ~0.4 kb fragment amplified from both samples revealed infection with the mild strain of TYLCV (TYLCV-Mld). A primer specific for TYLCV-Mld was designed (2070v, 5′-AAACGGAGAAATATATAAGGAGCC-3′), and PCR with the 2070v/1480c primer pair directed the amplification of the expected ~2.1 kb fragment from all 11 TYLC samples collected in 2011 that were PCR-negative for TYLCV-IL[DO] infection. Sequence analyses confirmed these were TYLCV-Mld fragments. The complete TYLCV-Mld genome was amplified from two samples from the Azua Valley with Templiphi, the amplified DNA products digested with Sal I, and the resulting ~2.8 kb fragments ligated into Sal I-digested pGEM-11. The complete sequences of these isolates were 2,791 nt and 99% identical to each other and 98% identical to sequences of TYLCV-Mld isolates. The TYLCV-Mld isolates from the DO were designated TYLCV-Mld:DO:TY5:01:2011 (KJ913682) and TYLCV-Mld:DO:TY5:02:2011 (KJ913683). A multimeric clone of TYLCV-Mld:DO:TY5:01:2011 was generated in the binary vector pCAMBIA1300 by cloning a 2.2 kb Sal I-EcoRI fragment containing the intergenic region to generate a 0.8-mer (pCTYMld0.8), and then the full-length Sal I fragment was cloned into the Sal I site of pCTYMld0.8 to generate a 1.8-mer (pCTYMldDO-01-1.8). Tomato plants agroinoculated with Agrobacterium tumefaciens carrying pCTYMldDO-01-1.8 developed severe TYLC disease symptoms 10 to 14 days after inoculation, whereas plants inoculated with a strain carrying the empty vector did not develop symptoms. Samples of processing tomatoes with TYLC were collected in 2012 to 2014 in the DO and tested for TYLCV-IL[DO] and TYLCV-Mld by PCR with the 2560v/1480c and 2070v/1480c primers pairs, respectively; these samples had infections of 93% (13/14), 86% (18/21), and 61% (11/18) with TYLCV-Mld; 29% (4/14), 19% (4/21), and 56% (10/18) with TYLCV-IL[DO]; and 21% (3/14), 5% (1/21), and 28% (5/18) with both viruses, respectively. These results reveal that there has been a striking population shift in the begomovirus causing TYLC in the DO, with TYLCV-Mld becoming predominant. This may reflect selection pressure(s) favoring a small pre-existing population of TYLCV-Mld, such as new tomato varieties, or a recent introduction event, such as that described in Venezuela (4). References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1994. (2) R. L. Gilbertson et al. Page 279 in: Tomato yellow leaf curl virus disease. Springer, 2007. (3) M. K. Nahkla et al. Plant Dis. 78:926, 1994. (4) G. Romay et al. Australasian Plant Dis. Notes, in press, 2014. (5) R. Salati et al. Phytopathology 92:487, 2002.

Sign in / Sign up

Export Citation Format

Share Document