Genetic Diversity of Nine Non-Recombinant Potato virus Y Isolates From Three Biological Strain Groups: Historical and Geographical Insights

Potato virus Y (PVY) isolates from potato currently exist as a complex of six biologically defined strain groups all containing nonrecombinant isolates and at least 14 recombinant minor phylogroups. Recent studies on eight historical UK potato PVY isolates preserved since 1984 found only nonrecombinants. Here, four of five PVY isolates from cultivated potato or wild Solanum spp. collected recently in Australia, Mexico, and the U.S.A. were typed by inoculation to tobacco plants and/or serological testing using monoclonal antibodies. Next, these five modern isolates and four additional historical UK isolates belonging to biological strain groups PVYC, PVYZ, or PVYN obtained from cultivated potato in 1943 to 1984 were sequenced. None of the nine complete PVY genomes obtained were recombinants. Phylogenetic analysis revealed that the four historical UK isolates were in minor phylogroups PVYC1 (YC-R), PVYO-O (YZ-CM1), PVYNA-N (YN-M), or PVYEu-N (YN-RM), Australian isolate YO-BL2 was in minor phylogroup PVYO-O5, and both Mexican isolate YN-Mex43 and U.S.A. isolates YN-MT12_Oth288, YN-MT12_Oth295, and YN-WWAA150131G42 were in minor phylogroup PVYEu-N. When combined, these new findings and those from the eight historical UK isolates sequenced earlier provide important historical insights concerning the diversity of early PVY populations in Europe and the appearance of recombinants in that part of the world. They and four recent Australian isolates sequenced earlier also provide geographical insights about the geographical distribution and diversity of PVY populations in Australia and North America.

Importance of the Host Phenotype on the Preservation of the Genetic Diversity in Codling Moth Granulovirus

To test the importance of the host genotype in maintaining virus genetic diversity, five experimental populations were constructed by mixing two Cydia pomonella granulovirus isolates, the Mexican isolate CpGV-M and the CpGV-R5, in ratios of 99% M + 1% R, 95% M + 5% R, 90% M + 10% R, 50% M + 50% R, and 10% M + 90% R. CpGV-M and CpGV-R5 differ in their ability to replicate in codling moth larvae carrying the type I resistance. This ability is associated with a genetic marker located in the virus pe38 gene. Six successive cycles of replication were carried out with each virus population on a fully-permissive codling moth colony (CpNPP), as well as on a host colony (RGV) that carries the type I resistance, and thus blocks CpGV-M replication. The infectivity of offspring viruses was tested on both hosts. Replication on the CpNPP leads to virus lineages preserving the pe38 markers characteristic of both isolates, while replication on the RGV colony drastically reduces the frequency of the CpGV-M pe38 marker. Virus progeny obtained after replication on CpNPP show consistently higher pathogenicity than that of progeny viruses obtained by replication on RGV, independently of the host used for testing.

Draft Genome Sequence of Escherichia coli Strain M15-4, a Typical Enteropathogenic E. coli Strain Isolated in Mexico

ABSTRACT We present here the first draft genome sequence of a typical enteropathogenic Escherichia coli serotype O55:H51 strain, M15-4, isolated from a 2-month-old infant girl with acute diarrhea. The study of this Mexican isolate will provide insights to the virulence and drug resistance traits involved in its pathogenic potential.

P'urhepecha hyperraising to object: An argument for purely altruistic movement

Classical syntactic theory was designed to ensure that raising would be able to proceed out of infinitival clauses, but not out of finite clauses. However, it has since become clear that a number of languages in fact allow raising out of finite clauses (hyperraising). This paper argues that the Mexican isolate P'urhepecha—more specifically, the variety spoken on the island of Janitzio on Lake Pátzcuaro—allows hyperraising to object (cf. Bruening 2002, Tanaka 2002, Halpert & Zeller 2015, Deal 2016), and develops an analysis of this phenomenon on which it involves two steps of purely altruistic (target-driven) movement—i.e., movement driven exclusively by a featural requirement of an attracting head. Alternative analyses of the phenomenon based on Greed (Chomsky 1995, Bošković 2007, a.o.) or Labeling (Chomsky 2013, 2015, a.o.) are considered and shown to face serious problems. P'urhepecha hyperraising to object, then, sheds light on the driving force for movement: it provides an argument for Enlightened Self-Interest (Lasnik 1995, 2003, a.o.), the hypothesis that movement may be driven by a feature either of the moving element or (as here) of an attracting head. The phenomenon also narrows down the space of possibilities for understanding the A/Ā-distinction.

Detection of Pineapple mealybug wilt-associated virus 1 and 3 in Mexico

<p>In El Bajo Papaloapan, the main producing area of pineapple of Mexico, leaves with typical symptoms of viral infection consisting in chlorosis, flaccidity, reduced growth and reddening were collected. By RT-PCR with specific primers for the hsp70 gene and subsequent sequencing were detected Pineapple mealybug wilt virus associated-virus 1 (PMWaV-1) and Pineapple mealybug wilt virus associated-3 (PMWaV-3). From the sequences obtained a tree was done with sequences from different regions of the world available in GenBank in order to know their similarity. The sequence obtained from the Mexican isolate PMWaV-1 was genetically related to the sequences of isolates from Cuba, Taiwan, Thailand and Hawaii and more distant from the Australian isolate. The sequence obtained for the Mexican isolate PMWaV-3 was more related to isolates from Hawaii, Cuba, Australia and Taiwan and more distant from the Thailand isolate. This is the first report of the presence of these two viruses in Mexico.</p>

First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease

Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.

Biological control of Haemonchus contortus infective larvae in ovine faeces by administering an oral suspension of Duddingtonia flagrans chlamydospores to sheep

A single oral dose of an aqueous suspension containing 11,350,000 chlamydospores of a Mexican isolate of Duddingtonia flagrans (FTHO-8) given to sheep, resulted in a maximum reduction of 88% (range 86.7–90.4%) of the population of Haemonchus contortus infective larvae in the faeces. The effect of this treatment continued for 4–5 days after administration of the suspension. The possible use of this treatment as a method of control of ovine haemonchosis is discussed.