scholarly journals First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1398-1398 ◽  
Author(s):  
I. E. Tzanetakis ◽  
W. M. Wintermantel ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Complete Sequence ◽  
Industry Studies ◽  
First Report ◽  
Leaf Chlorosis ◽  
Original Plant ◽  
Cloned Cdna ◽  
Beet Pseudo Yellows Virus ◽  
Minor Coat Protein

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAG- ATGTCCACTAATGATA 3′) were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.

scholarly journals First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 223-223 ◽  
Author(s):  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
South Carolina ◽  
The United States ◽  
Cdna Clones ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Beet Pseudo Yellows Virus ◽  
Symptomatic Plant

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAGATGTCCRCTAATGATA 3′) that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004.

scholarly journals First Report of Powdery Mildew Caused by an Oidium sp. on Banana Shrub (Michelia figo)

Plant Disease ◽  
1999 ◽  
Vol 83 (2) ◽  
pp. 198-198 ◽  
Author(s):  
G. E. Holcomb
Keyword(s):  
United States ◽  
Powdery Mildew ◽  
Baton Rouge ◽  
The United States ◽  
Sexual Stage ◽  
First Report ◽  
Leaf Chlorosis ◽  
Leaf Surfaces ◽  
Powdery Mildew Fungi ◽  
Severity Of The Disease

Banana shrub (Michelia figo (Lour.) Spreng.) is an evergreen grown in southern landscapes in hardiness zones 7 to 9. A powdery mildew disease has been observed sporadically on this plant for several years in the Baton Rouge area during fall months, but symptoms were always mild. During the summer and fall of 1998, banana shrub plants were observed with moderately severe powdery mildew infections that resulted in leaf chlorosis, distortion, and some defoliation. An Oidium sp. was present on both leaf surfaces, but sporulation was more abundant on the abaxial surfaces. Conidia were ellipsoid, produced in chains, devoid of conspicuous fibrosin bodies, and averaged 37 × 19 μm. No sexual stage was found. Conidia brushed from infected leaves to healthy leaves of a potted banana shrub maintained in a greenhouse caused new infections in 5 to 8 days. Factors responsible for the increased severity of the disease in 1998 are unknown, but the unusually dry summer may have contributed to the increased incidence of this disease. An Oidium sp. was listed on M. figo in Australia and the United States (1), but no other reports were found to confirm this. This is the first report of the occurrence of a powdery mildew on M. figo in the United States. Reference: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Press, Tokyo, 1986.

First Report of Pathogenicity of Fusarium sporotrichioides and Fusarium acuminatum on Sunflowers in the United States

2010 ◽  
Vol 11 (1) ◽  
pp. 42 ◽  
Author(s):  
F. Mathew ◽  
B. Kirkeide ◽  
T. Gulya ◽  
S. Markell
Keyword(s):  
United States ◽  
Helianthus Annuus ◽  
The United States ◽  
Fusarium Sporotrichioides ◽  
Charcoal Rot ◽  
Koch’S Postulates ◽  
First Report ◽  
Fusarium Acuminatum ◽  
Helianthus Annuus L ◽  
Koch's Postulates

Widespread infection of charcoal rot was observed in a commercial sunflower field in Minnesota in September 2009. Based on morphology, isolates were identified as F. sporotrichioides and F. acuminatum. Koch's postulates demonstrated pathogencity of both species. To our knowledge, this is the first report of F. sporotrichoides and F. acuminatum causing disease on Helianthus annuus L. in the United States. Accepted for publication 23 August 2010. Published 15 September 2010.

scholarly journals First Report of Wisteria vein mosaic virus in Wisteria sinensis in the United States of America

2008 ◽  
Vol 9 (1) ◽  
pp. 42 ◽  
Author(s):  
Rayapati A. Naidu ◽  
Gandhi Karthikeyan
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
United States Of America ◽  
The United States ◽  
Home Gardens ◽  
First Report ◽  
Woody Perennial ◽  
Wisteria Sinensis ◽  
First Time ◽  
Wisteria Vein Mosaic Virus

The ornamental Chinese wisteria (Wisteria sinensis) is a woody perennial grown for its flowering habit in home gardens and landscape settings. In this brief, the occurrence of Wisteria vein mosaic virus (WVMV) was reported for the first time in Chinese wisteria in the United States of America. Accepted for publication 18 June 2008. Published 18 August 2008.

Expansion of Groundnut ringspot virus Host and Geographic Ranges in Solanaceous Vegetables in Peninsular Florida

2011 ◽  
Vol 12 (1) ◽  
pp. 34 ◽  
Author(s):  
Craig G. Webster ◽  
William W. Turechek ◽  
H. Charles Mellinger ◽  
Galen Frantz ◽  
Nancy Roe ◽  
...  
Keyword(s):  
United States ◽  
The United States ◽  
Vegetable Production ◽  
Viral Pathogen ◽  
Geographic Ranges ◽  
First Report ◽  
Geographic Spread ◽  
Wide Range ◽  
Production Areas ◽  
Solanaceous Plants

To the best of our knowledge, this is the first report of GRSV infecting tomatillo and eggplant, and it is the first report of GRSV infecting pepper in the United States. This first identification of GRSV-infected crop plants in commercial fields in Palm Beach and Manatee Counties demonstrates the continuing geographic spread of the virus into additional vegetable production areas of Florida. This information indicates that a wide range of solanaceous plants is likely to be infected by this emerging viral pathogen in Florida and beyond. Accepted for publication 27 June 2011. Published 25 July 2011.

scholarly journals First Report of Colletotrichum queenslandicum on Persian Lime Causing Leaf Anthracnose in the United States

Plant Disease ◽  
2018 ◽  
Vol 102 (3) ◽  
pp. 677 ◽  
Author(s):  
M. Kunta ◽  
J.-W. Park ◽  
P. Vedasharan ◽  
J. V. da Graça ◽  
M. D. Terry
Keyword(s):  
United States ◽  
The United States ◽  
First Report

scholarly journals Fungicide Sensitivity of Pythium spp. Associated with Cavity Spot of Carrot in California and Michigan

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 384-388 ◽  
Author(s):  
Xiao Hong Lu ◽  
R. Michael Davis ◽  
S. Livingston ◽  
J. Nunez ◽  
Jianjun J. Hao
Keyword(s):  
United States ◽  
Growth Inhibition ◽  
Active Ingredient ◽  
Mycelial Growth ◽  
The United States ◽  
Fungicide Sensitivity ◽  
First Report ◽  
Cavity Spot ◽  
Pythium Violae

The identity of 172 isolates of Pythium spp. from cavity spot lesions on carrot produced in California and Michigan was determined, and their sensitivity to three fungicides was examined. Pythium violae accounted for 85% of California isolates, with P. irregulare, P. dissotocum (the first report as a carrot pathogen in the United States), P. ultimum, and P. sulcatum making the balance. P. sulcatum, P. sylvaticum, and P. intermedium were the most commonly recovered (85%) species in Michigan; others from Michigan included P. intermedium, P. irregulare, and an unclassified strain, M2-05. On fungicide-amended media, 93% of isolates were sensitive to mefenoxam (inhibition of mycelial growth was >60% at 10 μg active ingredient [a.i.]/ml); however, two of five isolates of P. irregulare from California were highly resistant (≤60% inhibition at 100 μg a.i./ml); about half of the isolates of P. intermedium and P. sylvaticum and a single isolate of P. violae were highly or intermediately resistant to mefenoxam (>60% inhibition at 100 μg a.i./ml, or ≤60% inhibition at 10 μg a.i./ml). P. dissotocum, P. irregulare, P. sulcatum, M2-05, and three of seven isolates of P. intermedium were insensitive to fluopicolide (effective concentrations for 50% growth inhibition [EC50] were >50 μg a.i./ml), while P. sylvaticum, P. ultimum, P. violae, and some isolates in P. intermedium were sensitive (EC50 < 1 μg a.i./ml). All isolates were sensitive to zoxamide (EC50 < 1 μg a.i./ml). Sensitivity baselines of P. violae to zoxamide and fluopicolide were established.

scholarly journals First Report of Macrophomina phaseolina Causing Trunk and Cordon Canker Disease of Grapevine in the United States

Plant Disease ◽  
2019 ◽  
Vol 103 (3) ◽  
pp. 579-579 ◽  
Author(s):  
M. T. Nouri ◽  
G. Zhuang ◽  
C. M. Culumber ◽  
F. P. Trouillas
Keyword(s):  
United States ◽  
Macrophomina Phaseolina ◽  
The United States ◽  
Canker Disease ◽  
First Report

scholarly journals First Report of Botrytis mali Causing Gray Mold on Strawberry in the United States

Plant Disease ◽  
2017 ◽  
Vol 101 (6) ◽  
pp. 1034 ◽  
Author(s):  
M. E. Dowling ◽  
G. Schnabel
Keyword(s):  
United States ◽  
The United States ◽  
Gray Mold ◽  
First Report
Sign in / Sign up

Export Citation Format

Share Document