scholarly journals First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 223-223 ◽  
Author(s):  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
South Carolina ◽  
The United States ◽  
Cdna Clones ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Beet Pseudo Yellows Virus ◽  
Symptomatic Plant

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAGATGTCCRCTAATGATA 3′) that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004.

scholarly journals First Report of Stem and Foliage Blight of Chrysanthemum Caused by Phytophthora drechsleri in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Charles Krasnow ◽  
Nancy Rechcigl ◽  
Jennifer Olson ◽  
Linus Schmitz ◽  
Steven N. Jeffers
Keyword(s):  
United States ◽  
South Carolina ◽  
Sequence Similarity ◽  
Morphological Characteristics ◽  
The United States ◽  
Universal Primers ◽  
Broad Host Range ◽  
Pathogenicity Test ◽  
First Report ◽  
Foliage Blight

Chrysanthemum (Chrysanthemum × morifolium) plants exhibiting stem and foliage blight were observed in a commercial nursery in eastern Oklahoma in June 2019. Disease symptoms were observed on ~10% of plants during a period of frequent rain and high temperatures (26-36°C). Dark brown lesions girdled the stems of symptomatic plants and leaves were wilted and necrotic. The crown and roots were asymptomatic and not discolored. A species of Phytophthora was consistently isolated from the stems of diseased plants on selective V8 agar (Lamour and Hausbeck 2000). The Phytophthora sp. produced ellipsoid to obpyriform sporangia that were non-papillate and persistent on V8 agar plugs submerged in distilled water for 8 h. Sporangia formed on long sporangiophores and measured 50.5 (45-60) × 29.8 (25-35) µm. Oospores and chlamydospores were not formed by individual isolates. Mycelium growth was present at 35°C. Isolates were tentatively identified as P. drechsleri using morphological characteristics and growth at 35°C (Erwin and Ribeiro 1996). DNA was extracted from mycelium of four isolates, and the internal transcribed spacer (ITS) region was amplified using universal primers ITS 4 and ITS 6. The PCR product was sequenced and a BLASTn search showed 100% sequence similarity to P. drechsleri (GenBank Accession Nos. KJ755118 and GU111625), a common species of Phytophthora that has been observed on ornamental and vegetable crops in the U.S. (Erwin and Ribeiro 1996). The gene sequences for each isolate were deposited in GenBank (accession Nos. MW315961, MW315962, MW315963, and MW315964). These four isolates were paired with known A1 and A2 isolates on super clarified V8 agar (Jeffers 2015), and all four were mating type A1. They also were sensitive to the fungicide mefenoxam at 100 ppm (Olson et al. 2013). To confirm pathogenicity, 4-week-old ‘Brandi Burgundy’ chrysanthemum plants were grown in 10-cm pots containing a peat potting medium. Plants (n = 7) were atomized with 1 ml of zoospore suspension containing 5 × 103 zoospores of each isolate. Control plants received sterile water. Plants were maintained at 100% RH for 24 h and then placed in a protected shade-structure where temperatures ranged from 19-32°C. All plants displayed symptoms of stem and foliage blight in 2-3 days. Symptoms that developed on infected plants were similar to those observed in the nursery. Several inoculated plants died, but stem blight, dieback, and foliar wilt were primarily observed. Disease severity averaged 50-60% on inoculated plants 15 days after inoculation. Control plants did not develop symptoms. The pathogen was consistently isolated from stems of symptomatic plants and verified as P. drechsleri based on morphology. The pathogenicity test was repeated with similar results. P. drechsleri has a broad host range (Erwin and Ribeiro 1996; Farr et al. 2021), including green beans (Phaseolus vulgaris), which are susceptible to seedling blight and pod rot in eastern Oklahoma. Previously, P. drechsleri has been reported on chrysanthemums in Argentina (Frezzi 1950), Pennsylvania (Molnar et al. 2020), and South Carolina (Camacho 2009). Chrysanthemums are widely grown in nurseries in the Midwest and other regions of the USA for local and national markets. This is the first report of P. drechsleri causing stem and foliage blight on chrysanthemum species in the United States. Identifying sources of primary inoculum may be necessary to limit economic loss from P. drechsleri.

scholarly journals First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
J. D. Postman ◽  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North America ◽  
Consensus Sequence ◽  
The United States ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Cdna Clones ◽  
Meristem Culture ◽  
Rt Pcr ◽  
First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

scholarly journals First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 648-648 ◽  
Author(s):  
R. L. Jordan ◽  
M. A. Guaragna ◽  
T. Van Buren ◽  
M. L. Putnam
Keyword(s):  
United States ◽  
Amino Acid ◽  
Mosaic Virus ◽  
The United States ◽  
Cdna Clones ◽  
Gene Products ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
First Report

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

scholarly journals First report of Meloidogyne javanica pathogenic on hybrid lavender (Lavandula ×intermedia) in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Samara A. Oliveira ◽  
Daniel M. Dlugos ◽  
Paula Agudelo ◽  
Steven N. Jeffers
Keyword(s):  
South Carolina ◽  
Sandy Loam ◽  
Meloidogyne Javanica ◽  
The United States ◽  
Crown Rot ◽  
Cultivated Plants ◽  
Broad Host Range ◽  
First Report ◽  
Tomato Roots ◽  
The Usa

Root-knot nematodes (RKNs), Meloidogyne spp., are some of the most economically important pathogens of cultivated plants. Meloidogyne javanica is one of the most destructive RKN species and is well known for its broad host range and the severe damage it causes to plant roots (Perry et al. 2009). In Feb 2018, four mature dead and dying hybrid lavender plants (Lavandula ×intermedia ‘Phenomenal’) were collected in Edgefield County, South Carolina, and suspected of having Phytophthora root and crown rot (Dlugos and Jeffers 2018). Greenhouse-grown plants had been transplanted in Dec 2016 and Jan 2017 into a sandy loam soil on a site that had been fallow or in pasture for over 30 years. Some plants began to turn gray and die in summer 2017, and approximately 40% of 1230 plants were symptomatic or dead by Feb 2018. Phytophthora spp. were not isolated from the collected plants but were isolated from plants collected on subsequent visits. Instead, all four plants had small, smooth galls on the roots. Lavender roots were examined microscopically (30-70×), and egg masses of RKNs were observed on the galls. Mature, sedentary RKN females were handpicked from galled roots, and perineal patterns of 10 specimens were examined and identified as M. javanica. Juveniles and eggs were extracted from lavender roots by the method of Coolen and D’herde (1972). To confirm species identification, DNA was extracted from 10 individual juveniles, and a PCR assay was conducted using species-specific primers for M. javanica, Fjav/Rjav (Zijlstra et al. 2000). A single amplicon was produced with the expected size of approximately 720 bp, which confirmed identity as M. javanica. To determine pathogenicity, M. javanica from lavender roots were inoculated onto susceptible tomato plants for multiplication, and severe gall symptoms occurred on tomato roots 60 days later. Nematodes were extracted from tomato roots and inoculated onto healthy, rooted cuttings of ‘Phenomenal’ lavender plants growing in pots of soilless medium in a greenhouse. Plants were inoculated with 0, 1000, 2000, 5000, or 10000 eggs and juveniles of M. javanica. Five single-plant replicates were used for each treatment, and plants were randomized on a greenhouse bench. Plants were assessed 60 days after inoculation, and nematodes were extracted from roots and counted. The reproduction factor was 0, 43.8, 40.9, 9.1, 7.7, and 2.6 for initial nematode populations 0, 1000, 2000, 5000, and 10000, respectively, which confirmed pathogenicity (Hussey and Janssen 2002). Meloidogyne javanica also was recovered in Mar 2018 from galled roots on a ‘Munstead’ (L. angustifolia) lavender plant from Kentucky (provided by the Univ. of Kentucky Plant Disease Diagnostic Laboratories), and an unidentified species of Meloidogyne was isolated in Aug 2020 from a ‘Phenomenal’ plant grown in Florida. COI mtDNA sequences from the SC (MZ542457) and KY (MZ542458) populations were submitted to Genbank. M. javanica previously was found associated with field-grown lavender (hybrid and L. angustifolia) in Brazil, but pathogenicity was not studied (Pauletti and Echeverrigaray 2002). To our knowledge, this is the first report of M. javanica pathogenic to L. ×intermedia in the USA, and the first time RKNs have been proven to be pathogenic to Lavandula spp. following Koch’s Postulates. Further studies are needed to investigate the geographic distribution of M. javanica on lavender and the potential threat this nematode poses to lavender production in the USA.

scholarly journals First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Gardenia Orellana ◽  
Alexander V Karasev
Keyword(s):  
United States ◽  
Leaf Tissue ◽  
The United States ◽  
Universal Primers ◽  
Rt Pcr ◽  
Universal Primer ◽  
Tissue Samples ◽  
First Report ◽  
Specific Pcr ◽  
Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

scholarly journals Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 292-297 ◽  
Author(s):  
Mohamad Chikh-Ali ◽  
Hayam Alruwaili ◽  
Dalton Vander Pol ◽  
Alexander V. Karasev
Keyword(s):  
United States ◽  
Saudi Arabia ◽  
Seed Potato ◽  
Potato Virus ◽  
Potato Virus Y ◽  
The United States ◽  
Tuber Quality ◽  
Rt Pcr ◽  
First Report ◽  
Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

scholarly journals First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1398-1398 ◽  
Author(s):  
I. E. Tzanetakis ◽  
W. M. Wintermantel ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Complete Sequence ◽  
Industry Studies ◽  
First Report ◽  
Leaf Chlorosis ◽  
Original Plant ◽  
Cloned Cdna ◽  
Beet Pseudo Yellows Virus ◽  
Minor Coat Protein

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAG- ATGTCCACTAATGATA 3′) were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.

scholarly journals First Report of Tobacco ringspot virus in Blackberry (Rubus sp.) in Alabama

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708 ◽  
Author(s):  
E. Coneva ◽  
J. F. Murphy ◽  
R. Boozer ◽  
N. Velásquez
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Virus Infection ◽  
The United States ◽  
Negative Control ◽  
Ringspot Virus ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Control Samples

In 2006, primocane stunted growth and crumbly berry development were observed on 4-year-old Kiowa and Apache blackberry cultivars grown at the Chilton Research and Extension Center, Clanton, AL. Samples from affected plants were tested for virus infection by ELISA kits (Agdia, Inc., Elkhart, IN) specific to each of 14 different viruses. Most samples tested positive for Tobacco ringspot virus (TRSV). TRSV was detected in blackberry samples from North Carolina and South Carolina (2). Bray et al. (1) studied the incidence of viruses in blackberry nursery stock in the United States and reported that 9% of the tested samples contained TRSV. Thus, a survey was conducted for TRSV incidence among commercial blackberry stands in eight counties in Alabama during July 2007. Blackberry plants were observed to express virus-like symptoms including chlorotic spots on leaves, leaf veinal chlorosis, stunting, and combinations thereof. Fruit-bearing plants sometimes had crumbly fruit symptoms characteristic of virus infection. Leaf samples that were collected from symptomatic and nonsymptomatic plants representing 14 cultivars were tested by TRSV ELISA (Agdia, Inc.). Of 180 blackberry samples, 68 tested positive for TRSV. Positive ELISA reactions for TRSV were on average 28 times greater than the reactions of known negative control samples considered negative for TRSV. Blackberry plants shown to be infected with TRSV during the 2007 survey were tested in July 2008 in an effort to confirm the presence of TRSV. Fifty-four percent of the samples tested positive by ELISA with the average positive ELISA value being 21 times higher than the average negative ELISA value for known negative control samples. To further confirm the occurrence of TRSV in Alabama-grown blackberry plants, leaf samples were tested by reverse transcription (RT)-PCR to amplify a 329-bp fragment of the viral coat protein gene (TRSV RNA 2 sequence accession no. NC_005096; primers TRSCP-F (5′-TCTGGCACTATAAGCGGAAG-3′) and TRSCP-R (5′-GAAAACATGGGAGGATGCAC-3′). A single band of the anticipated size was amplified (analyzed by agarose gel electorphoresis and visualized by ethidium bromide staining) from RNA samples extracted with a RNeasy Mini kit (Qiagen, Valencia, CA) from blackberry samples that tested positive for TRSV by ELISA and a known positive control. No amplified product resulted from a blackberry sample that tested negative for TRSV by ELISA. These results illustrate and confirm the presence of TRSV in blackberry leaf tissues grown in Alabama. To our knowledge, this is the first report of TRSV infection of blackberry plants in Alabama. References: (1) M. M. Bray et al. HortScience 40:874, 2005. (2) T. L. Guzmán-Baeny. Incidence, distribution, and symptom description of viruses in cultivated blackberry (Rubus subgenus Eubatus) in the southeastern United States. M.S. thesis, North Carolina State University, Raleigh, 2003.

scholarly journals First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 463-463 ◽  
Author(s):  
I. E. Tzanetakis ◽  
J. D. Postman ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Ringspot Virus ◽  
Tobacco Streak Virus ◽  
Rapid Decline ◽  
Streak Virus ◽  
Black Raspberry ◽  
Rt Pcr ◽  
Indicator Plants ◽  
First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

scholarly journals First Report of Laurel Wilt Caused by Raffaelea lauricola on Sassafras in Mississippi

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1479-1479 ◽  
Author(s):  
J. J. Riggins ◽  
S. W. Fraedrich ◽  
T. C. Harrington
Keyword(s):  
United States ◽  
South Carolina ◽  
The United States ◽  
Ambrosia Beetle ◽  
Malt Extract ◽  
Laurel Wilt ◽  
First Report ◽  
Raffaelea Lauricola ◽  
Redbay Ambrosia Beetle ◽  
Soil Interface

Laurel wilt is caused by the fungus Raffaelea lauricola T.C. Harrin., Aghayeva & Fraedrich and is lethal to redbay (Persea borbonia (L.) Spreng.), sassafras (Sassafras albidum (Nutt.) Nees), and other species in the Lauraceae (1). The fungus is carried by the redbay ambrosia beetle (Xyleborus glabratus Eichh.), which is native to Asia. After being discovered in Georgia in 2002 (1), X. glabratus and R. lauricola have spread rapidly, causing extensive redbay mortality in South Carolina, Georgia, Florida, and Mississippi (1,4). The disease has also been confirmed on sassafras in Florida, South Carolina (1), and Georgia. Questions remain as to whether laurel wilt will continue to spread on sassafras, which often occurs as scattered trees in the eastern United States. In June 2010, a homeowner reported that a sassafras tree north of Van Cleave, MS (30.668°N, 88.686°W) had begun wilting in late May. This landscape tree had three 10-m high stems (~20 cm in diameter at breast height). Dark staining in the xylem was observed around the entire circumference of all three stems and nearly all leaves were bronze colored and wilted. No ambrosia beetle tunnels were observed in the stems. No other symptomatic Lauraceae were encountered in the wooded area within 300 m. The nearest known location with laurel wilt on redbay was ~15 km away (4). A Lindgren funnel trap baited with manuka oil (2) was placed at the site in June and monitored biweekly until November, but no X. glabratus adults were captured. Chips from discolored xylem of the sassafras were surface sterilized, plated on cycloheximide-streptomycin malt agar, and R. lauricola was readily isolated (1). Identity of the fungus (isolate C2792 in collection of T. Harrington) was confirmed by using partial sequences of the 28S rDNA (3). The sassafras sequence was identical to that of all known sequences of R. lauricola in the United States, including GenBank No. EU123076 (the holotype isolate from redbay). To confirm pathogenicity, isolate C2792 was grown on malt extract agar and three redbay (average: 141 cm high and 12 mm in diameter at soil interface) and three sassafras (average: 170 cm high and 17 mm in diameter at soil interface) potted plants were wound inoculated with 0.2 ml of a spore suspension (4.9 × 106 conidia/ml) (1). Three control plants of each species were inoculated with sterile deionized water. After 8 weeks in a growth chamber at 26°C, all inoculated redbay and sassafras plants exhibited xylem discoloration above and below the inoculation point, two of the redbay and two of the sassafras had died, and the other plant of each species exhibited partial wilt (the main terminal or one or more branches). All control plants were asymptomatic. R. lauricola was reisolated from all inoculated symptomatic plants but not from controls. To our knowledge, this is the first report of laurel wilt on sassafras in Mississippi. Both redbay (4) and sassafras appear to be highly susceptible to the disease as it moves westward. Sassafras is less attractive than redbay to X. glabratus and it was thought that this might contribute to slowing the spread of laurel wilt once outside the range of redbay (2). Nonetheless, our observations confirm that sassafras can be infected where laurel wilt on redbay is not in the immediate vicinity. References: (1) S. W. Fraedrich et al. Plant Dis. 92:215, 2008. (2) J. L. Hanula et al. J. Econ. Entomol. 101:1276, 2008. (3) T. C. Harrington et al. Mycotaxon 111:337, 2010. (4) J. J. Riggins et al. Plant Dis. 94:634, 2010.

Sign in / Sign up

Export Citation Format

Share Document