First Report of Powdery Mildew Caused by an Oidium sp. on Banana Shrub (Michelia figo)

Banana shrub (Michelia figo (Lour.) Spreng.) is an evergreen grown in southern landscapes in hardiness zones 7 to 9. A powdery mildew disease has been observed sporadically on this plant for several years in the Baton Rouge area during fall months, but symptoms were always mild. During the summer and fall of 1998, banana shrub plants were observed with moderately severe powdery mildew infections that resulted in leaf chlorosis, distortion, and some defoliation. An Oidium sp. was present on both leaf surfaces, but sporulation was more abundant on the abaxial surfaces. Conidia were ellipsoid, produced in chains, devoid of conspicuous fibrosin bodies, and averaged 37 × 19 μm. No sexual stage was found. Conidia brushed from infected leaves to healthy leaves of a potted banana shrub maintained in a greenhouse caused new infections in 5 to 8 days. Factors responsible for the increased severity of the disease in 1998 are unknown, but the unusually dry summer may have contributed to the increased incidence of this disease. An Oidium sp. was listed on M. figo in Australia and the United States (1), but no other reports were found to confirm this. This is the first report of the occurrence of a powdery mildew on M. figo in the United States. Reference: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Press, Tokyo, 1986.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces orontii on Corn-Salad in the United States

Plant Disease ◽

10.1094/pd-89-0686c ◽

2005 ◽

Vol 89 (6) ◽

pp. 686-686 ◽

Cited By ~ 1

Author(s):

S. T. Koike ◽

G. S. Saenz

Keyword(s):

United States ◽

Powdery Mildew ◽

Mycelial Growth ◽

Leaf Growth ◽

The United States ◽

First Report ◽

Powdery Mildews ◽

Leaf Surfaces ◽

Germ Tubes ◽

Symptoms And Signs

Corn-salad or lamb's lettuce (Valerianella locusta) is a specialty leafy green, annual vegetable that is grown commercially in California for use in salads. During the summer (June through August) of 2004, field plantings in coastal California (Monterey County) showed symptoms and signs of a powdery mildew. White, ectophytic mycelia and conidia were present on leaves and petioles. Extensively colonized leaves were slightly twisted and later developed a tan necrosis. Mycelial growth was spread out, flat, sometimes dense, and colonized both sides of the leaf. Growth was more extensive on the upper leaf surfaces. Hyphae were 5 to 7.5 μm wide with nipple-shaped appressoria. Conidiophores were straight and had foot cells that were simple, mostly curved, measured 50 to 65 × 10 to 12.5 μm, and followed by two to three cells of equal size. Conidia developed in short chains. Conidia were cylindric to doliform, measured 27.5 to 32.5 × 15 to 17.5 μm, and lacked fibrosin bodies. Conidial length-to-width ratios were usually less than or equal to 2.0. Conidia germinated at the ends (cichoracearum-type) and had germ tube lengths that ranged from short to 1.0 to 1.5 times the length of the conidium; germ tubes had swollen tips. Cleistothecia were not observed. On the basis of these characteristics, the fungus is identified as Golovinomyces (Erysiphe) orontii(Cast.) Heluta (1). To demonstrate pathogenicity, heavily colonized corn-salad leaves from commercial plantings were collected and gently pressed onto leaves of potted corn-salad plants. Plants were then maintained in a greenhouse (22 to 24°C). After 8 to 10 days, symptoms and signs of powdery mildew developed on the foliage of inoculated plants, and the pathogen morphology matched that of the originally observed pathogen. Noninoculated control plants did not develop powdery mildew. To our knowledge, this is the first report of powdery mildew of corn-salad caused by G. orontii in the United States. This corn-salad disease has been reported from a number of countries in Europe (2). Because the presence of powdery mildew on the harvested foliage made the leaves unmarketable, part of the crop could not be sold. References: (1) U. Braun. Nova Hedwigia 89:1, 1987. (2) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995.

Download Full-text

First Report of Impatiens Downy Mildew Outbreaks Caused by Plasmopara obducens Throughout the Hawai'ian Islands

Plant Disease ◽

10.1094/pdis-10-13-1017-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 696-696 ◽

Cited By ~ 7

Author(s):

J. A. Crouch ◽

M. P. Ko ◽

J. M. McKemy

Keyword(s):

United States ◽

Downy Mildew ◽

The United States ◽

Molecular Data ◽

Economic Losses ◽

Voucher Specimen ◽

First Report ◽

Plastic Bags ◽

Leaf Surfaces ◽

Impatiens Walleriana

Downy mildew of impatiens (Impatiens walleriana Hook.f.) was first reported from the continental United States in 2004. In 2011 to 2012, severe and widespread outbreaks were documented across the United States mainland, resulting in considerable economic losses. On May 5, 2013, downy mildew disease symptoms were observed from I. walleriana ‘Super Elfin’ at a retail nursery in Mililani, on the Hawai'ian island of Oahu. Throughout May and June 2013, additional sightings of the disease were documented from the islands of Oahu, Kauai, Maui, and Hawai'i from nurseries, home gardens, and botanical park and landscape plantings. Symptoms of infected plants initially showed downward leaf curl, followed by a stippled chlorotic appearance on the adaxial leaf surfaces. Abaxial leaf surfaces were covered with a layer of white mycelia. Affected plants exhibited defoliation, flower drop, and stem rot as the disease progressed. Based on morphological and molecular data, the organism was identified as Plasmopara obducens (J. Schröt.) J. Schröt. Microscopic observation disclosed coenocytic mycelium and hyaline, thin-walled, tree-like (monopodial branches), straight, 94.0 to 300.0 × 3.2 to 10.8 μm sporangiophores. Ovoid, hyaline sporangia measuring 11.0 to 14.6 × 12.2 to 16.2 (average 13.2 × 14.7) μm were borne on sterigma tips of rigid branchlets (8.0 to 15.0 μm) at right angle to the main axis of the sporangiophores (1,3). Molecular identification of the pathogen was conducted by removing hyphae from the surface of three heavily infected leaves using sterile tweezers, then extracting DNA using the QIAGEN Plant DNA kit (QIAGEN, Gaithersburg, MD). The nuclear rDNA internal transcribed spacer was sequenced from each of the three samples bidirectionally from Illustra EXOStar (GE Healthcare, Piscataway, NJ) purified amplicon generated from primers ITS1-O and LR-0R (4). Resultant sequences (GenBank KF366378 to 80) shared 99 to 100% nucleotide identity with P. obducens accession DQ665666 (4). A voucher specimen (BPI892676) was deposited in the U.S. National Fungus Collections, Beltsville, MD. Pathogenicity tests were performed by spraying 6-week-old impatiens plants (I. walleriana var. Super Elfin) grown singly in 4-inch pots with a suspension of 1 × 104 P. obducens sporangia/ml until runoff using a handheld atomizer. Control plants were sprayed with distilled water. The plants were kept in high humidity by covering with black plastic bags for 48 h at 20°C, and then maintained in the greenhouse (night/day temperature of 20/24°C). The first symptoms (downward curling and chlorotic stippling of leaves) and sporulation of the pathogen on under-leaf surfaces of the inoculated plants appeared at 10 days and 21 days after inoculation, respectively. Control plants remained healthy. Morphological features and measurements matched those of the original inoculum, thus fulfilling Koch's postulates. To our knowledge, this is the first report of downy mildew on I. walleriana in Hawai'i (2). The disease appears to be widespread throughout the islands and is likely to cause considerable losses in Hawai'ian landscapes and production settings. References: (1) O. Constantinescu. Mycologia 83:473, 1991. (2) D. F. Farr and A. Y. Rossman. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ July 16, 2013. (3) P. A. Saccardo. Syllogue Fungorum 7:242, 1888. (4) M. Thines. Fungal Genet Biol 44:199, 2007.

Download Full-text

First Report of Powdery Mildew Caused by Erysiphe aquilegiae var. aquilegiae on Aquilegia flabellata in Italy

Plant Disease ◽

10.1094/pdis.2004.88.6.681a ◽

2004 ◽

Vol 88 (6) ◽

pp. 681-681

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

United States ◽

Powdery Mildew ◽

The United States ◽

Northern Italy ◽

American Phytopathological Society ◽

First Report ◽

Powdery Mildews ◽

The Family ◽

White Mycelium ◽

The University

Aquilegia flabellata Sieb. and Zucc. (columbine) is a perennial garden species belonging to the family Ranunculaceae. During the summer of 2003, a severe outbreak of a previously unknown powdery mildew was observed in several gardens near Biella (northern Italy). Upper surfaces of leaves were covered with a white mycelium and conidia, and as the disease progressed infected leaves turned yellow and died. Foot cell was cylindric and appressorium lobed. Conidia were hyaline, ellipsoid, and measured 31.2 to 47.5 × 14.4 to 33 μm (average 38.6 × 21.6 μm). Fibrosin bodies were not present. Cleistothecia were globose, brown, had simple appendages, ranged from 82 to 127 (average 105) μm in diameter, and contained one to two asci. Ascocarp appendages measured five to eight times the ascocarp diameter. Asci were cylindrical (ovoidal) and measured 45.3 to 58.2 × 30.4 to 40.2 μm. Ascospores (three to four per ascus) were ellipsoid or cylindrical and measured 28.3 to 31.0 × 14.0 to 15.0 μ;m. On the basis of its morphology, the pathogen was identified as Erysiphe aquilegiae var. aquilegiae (1). Pathogenicity was confirmed by gently pressing diseased leaves onto leaves of five, healthy A. flabellata plants. Five noninoculated plants served as controls. Inoculated and noninoculated plants were maintained in a garden where temperatures ranged between 20 and 30°C. After 10 days, typical powdery mildew symptoms developed on inoculated plants. Noninoculated plants did not show symptoms. To our knowledge, this is the first report of the presence of powdery mildew on Aquilegia flabellata in Italy. E. communis (Wallr.) Link and E. polygoni DC. were reported on several species of Aquilegia in the United States (2), while E. aquilegiae var. aquilegiae was previously observed on A. flabellata in Japan and the former Union of Soviet Socialist Republics (3). Specimens of this disease are available at the DIVAPRA Collection at the University of Torino. References: (1) U. Braun. Nova Hedwigia, 89:700, 1987. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (3) K. Hirata. Host Range and Geographical Distribution of the Powdery Mildews. Faculty of Agriculture, Niigata University, 1966.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces spadiceus on Okra in the United States

Plant Disease ◽

10.1094/pdis-01-18-0179-pdn ◽

2018 ◽

Vol 102 (8) ◽

pp. 1664-1664 ◽

Cited By ~ 5

Author(s):

S. Moparthi ◽

M. Bradshaw ◽

K. Frost ◽

P. B. Hamm ◽

J. W. Buck

Keyword(s):

United States ◽

Powdery Mildew ◽

The United States ◽

First Report

Download Full-text

Perpetuation of Powdery Mildew Infection and Identification of Erysiphe australiana as the Crape Myrtle Pathogen in Mid-Tennessee

Plant Disease ◽

10.1094/pd-90-1098 ◽

2006 ◽

Vol 90 (8) ◽

pp. 1098-1101 ◽

Cited By ~ 11

Author(s):

Ainong Shi ◽

Margaret T. Mmbaga

Keyword(s):

United States ◽

Powdery Mildew ◽

The United States ◽

Diagnostic Tools ◽

Specific Primers ◽

Standard Polymerase Chain Reaction ◽

Common Lilac ◽

Pcr Products ◽

Powdery Mildew Fungi ◽

Powdery Mildew Pathogen

The fungus Erysiphe lagerstroemiae is commonly known as the powdery mildew pathogen in crape myrtle (Lagerstroemiae indica) in the United States, and Erysiphe australiana is the powdery mildew pathogen reported in Japan, China, and Australia. The teleomorph often used to identify powdery mildew fungi rarely develops in crape myrtle, and in our observations, ascocarps never formed. Our study showed that the crape myrtle pathogen overwintered as mycelia on dormant buds. The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs ITS1 and ITS4. PCR products were analyzed by electrophoresis in a 1.5% agarose gel and sequenced, and the ITS PCR product was 666 bp from ITS1/ITS4 and 704 bp from ITS1-F/ITS4. BLAST analysis of the sequence of the PCR products showed identical similarity with E. australiana reported in Japan, China, and Australia. Comparison of ITS sequences with information in the GenBank on other powdery mildew fungi showed a closest alignment (93% similarity) to Erysiphe juglandis that infects walnut. Specific primers for E. australiana were developed and evaluated for use as diagnostic tools. Out of 12 specific primer pairs evaluated, four primer pairs and four double primer pairs were highly specific to E. australiana and did not amplify Erysiphe pulchra of dogwood, Erysiphe syringae of common lilac, Erysiphe circinata of maple, or Phyllactinia guttata of oak. The E. australiana-specific primers amplified 16 samples of crape myrtle powdery mildew collected from diverse locations in mid-Tennessee. These results clearly showed that the crape myrtle powdery mildew in mid-Tennessee was caused by E. australiana. Specific primers reported in this article provide a diagnostic tool and may be used to confirm the identity of crape myrtle powdery mildew pathogen in other areas in the United States and wherever the disease occurs.

Download Full-text

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease

Plant Disease ◽

10.1094/pdis.2003.87.11.1398c ◽

2003 ◽

Vol 87 (11) ◽

pp. 1398-1398 ◽

Cited By ~ 20

Author(s):

I. E. Tzanetakis ◽

W. M. Wintermantel ◽

R. R. Martin

Keyword(s):

United States ◽

The United States ◽

Complete Sequence ◽

Industry Studies ◽

First Report ◽

Leaf Chlorosis ◽

Original Plant ◽

Cloned Cdna ◽

Beet Pseudo Yellows Virus ◽

Minor Coat Protein

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAG- ATGTCCACTAATGATA 3′) were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.

Download Full-text

First Report of Powdery Mildew Caused by Podosphaera aphanis var. aphanis on Potentilla fruticosa in Italy

Plant Disease ◽

10.1094/pd-89-1362c ◽

2005 ◽

Vol 89 (12) ◽

pp. 1362-1362

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

United States ◽

Powdery Mildew ◽

The United States ◽

Pathogenicity Test ◽

First Report ◽

Potentilla Fruticosa ◽

Erysiphe Polygoni ◽

Voucher Specimens ◽

White Mycelium ◽

Sphaerotheca Macularis

Potentilla fruticosa L. (bush cinquefoil), belonging to the family Rosaceae, is an ornamental plant used in parks and gardens. During the spring and summer of 2005, severe outbreaks of a previously unknown powdery mildew were observed in several private gardens located near Biella (northern Italy). The adaxial and abaxial surfaces of leaves as well as the stems were covered with white mycelium. Buds and flowers also were affected. As disease progressed, infected leaves turned yellow and dehisced. Conidia formed in chains and were hyaline, ovoid, and measured 24.0 to 36.0 × 15.8 to 24.0 μm (average 30.1 × 20.0 μm). Fibrosin bodies were present. Chasmothecia were numerous, sphaerical, amber colored, and diameters ranged from 84.0 to 98.4 μm (average 90.4 μm). Each chasmothecium contained one ascus with eight ascospores. Ascospores measured 26.5 to 27.2 × 13.2 to 15.6 μm (average 26.8 × 14.0 μm). On the basis of its morphology, the causal agent was determined to be Podosphaera aphanis (Wallr.) U. Braun & S. Takamatsu var. aphanis U. Braun (1). Pathogenicity was confirmed through inoculations by gently pressing diseased leaves onto leaves of healthy P. fruticosa plants. Three plants were inoculated. Three noninoculated plants served as a control. Plants were maintained at temperatures ranging from 12 to 23°C. Ten days after inoculation, typical symptoms of powdery mildew developed on inoculated plants. Noninoculated plants did not show symptoms. The pathogenicity test was carried out twice. To our knowledge, this is the first report of powdery mildew on P. fruticosa in Italy. Erysiphe polygoni D.C. and Sphaerotheca macularis (Wallr.:Fr.) Lind were observed in the United States on P. fruticosa (2), while in Japan, the presence of S. aphanis var aphanis was reported (3). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) U. Braun and S. Takamatsu. Schlechtendalia 4:1, 2000 (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (3) S. Tanda et al. J. Agric. Sci. 39:258, 1995.

Download Full-text

First Report of Powdery Mildew Caused by Erysiphe platani on Sycamore (Platanus occidentalis) in South Korea

Plant Disease ◽

10.1094/pdis-10-12-0940-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 841-841

Author(s):

H. B. Lee ◽

H. W. Lee ◽

H. Y. Mun

Keyword(s):

United States ◽

Powdery Mildew ◽

South Korea ◽

Sequence Data ◽

Average Rate ◽

Nationwide Survey ◽

The United States ◽

High Sequence Identity ◽

First Report ◽

Platanus Occidentalis

Platanus occidentalis L. (sycamore) is an important shade tree distributed throughout the Northern Hemisphere and in South Korea. It has been widely used as an ornamental tree, especially in urban regions and by roadsides. The average rate of roadside planting throughout South Korea covers about 5.7% (up to 38% in Seoul), equivalent to 0.36 million trees. In early July 2012, after a rainy spell in summer, an outbreak of powdery mildew on sycamore was first observed on roadside trees in Gwangju, a southern province of South Korea. A more extensive nationwide survey revealed no powdery mildew in northern or central regions of South Korea. The disease has spread rapidly within Gwangju, even though fungicide applications were carried out after the rainy spell. Major symptoms included white, superficial mycelia, grey to brown lesions on the surface of the leaves due to the presence of a hyperparasite (tentatively identified as Ampelomyces sp.), a slight chlorosis, and severe leaf distortion followed by defoliation. Conidiophores were produced singly, straight, and unbranched, with lengths of 35.2 to 315.2 μm (average 170.4 μm). Conidia were ellipsoid or doliiform, ranging in size from 34.9 to 47.4 μm (average 38.2 μm) long × 16.5 to 26.8 μm (average 23.9 μm) wide. Primary conidia had a truncate base and rounded apex; secondary conidia had both a truncate base and apex. The conidial outer surface had a reticulated wrinkling. Cleistothecia (i.e., sexual spore structures) were not found during the survey, which extended from July to October. These characteristics and the host species match those of Microsphaera platani (syn. Erysiphe platani), which was described on P. occidentalis in Washington State (2). Fungal rDNA was amplified using primers ITS1 and LR5F (4) for one sample (EML-PLA1, GenBank JX485651). BLASTn searches of GenBank revealed high sequence identity to E. platani (99.5% to JQ365943 and 99.3% to JQ365940). Recently, Liang et al. (3) reported the first occurrence of powdery mildew by E. platani on P. orientalis in China based only on its morphology. Thus, in this study, author could only use ITS sequence data from the United States and Europe to characterize the isolate. To date, nine records of powdery mildews of Platanus spp. have been reported worldwide: on P. hispanica from Brazil, Japan, Hungary, and Slovakia; P. orientalis from Israel; P. racemosa from the United States; P. × acerifolia from the United Kingdom and Germany; and Platanus sp. from Argentina and Australia (1). Interestingly, the hyperparasite, Ampelomyces sp., was found with E. platani, suggesting that there may be some level of biocontrol in nature. Pathogenicity was confirmed by gently pressing diseased leaves onto six leaves of healthy sycamore plants in the field in September. The treated leaves were sealed in sterilized vinyl pack to maintain humid condition for 2 days. Similar symptoms were observed on the inoculated leaves 10 days after inoculation. Koch's postulates were fulfilled by re-observing the fungal pathogen. To our knowledge, this is the first report of powdery mildew caused by E. platani on sycamore in South Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. http://nt.ars-grin.gov/fungaldatabases/ , 2012. (2) D. A. Glawe. Plant Health Progress, doi:10.1094/PHP-2003-0818-01-HN, 2003. (3) C. Liang et al. Plant Pathol. 57:375, 2008. (4) T. J White et al., pp. 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., ed. Academic Press, New York, 1990.

Download Full-text

First Report of Powdery Mildew, Caused by an Oidium sp., on Poinsettia in California

Plant Disease ◽

10.1094/pdis.1998.82.1.128a ◽

1998 ◽

Vol 82 (1) ◽

pp. 128-128 ◽

Cited By ~ 3

Author(s):

S. T. Koike ◽

G. S. Saenz

Keyword(s):

United States ◽

Powdery Mildew ◽

Pacific Northwest ◽

The United States ◽

Euphorbia Pulcherrima ◽

American Phytopathological Society ◽

First Report ◽

The Pacific ◽

Uninoculated Control ◽

Alternative Identification

In December 1996 and January 1997, powdery mildew was observed on potted poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch) plants in Monterey County, CA. Mycelia were observed on stems, petioles, mature and immature leaves, and bracts. Severely diseased leaves became twisted and bent and senesced prematurely. The white mycelia were conspicuous, epiphytic, and amphigenous; hyphae measured 4.6 to 6.9 μm in diameter. Growth initially was in patches but eventually became effused. Appressoria were slightly lobed to lobed and sometimes opposite. Conidiophore foot cells were cylindrical, sometimes bent at the base, and slightly flexuous to flexuous. Foot cells measured 30.0 to 46.2 μm × 5.8 to 6.9 μm and were followed by one to two shorter cells. Conidia were cylindrical to slightly doliform and measured 25.4 to 32.3 μm × 11.6 to 18.5 μm. The length-to-width ratios of conidia generally were greater than 2.0. Conidia were produced singly, placing the fungus in the Pseudoidium-type powdery mildew group. Conidia germinated at the ends, and no fibrosin bodies were observed. Cleistothecia were not found. The fungus was identified as an Oidium species. Pathogenicity was demonstrated by gently pressing infected leaves having abundant sporulation onto leaves of potted poinsettia plants (cvs. Freedom Red, Peter Star Marble, and Nutcracker White), incubating the plants in a moist chamber for 48 h, and then maintaining plants in a greenhouse. After 12 to 14 days, powdery mildew colonies developed on the inoculated plants, and the pathogen was morphologically identical to the original isolates. Uninoculated control plants did not develop powdery mildew. This is the first report of powdery mildew on poinsettia in California. This fungus appears similar to Microsphaera euphorbiae but has longer, slightly flexuous foot cells that do not match the description for M. euphorbiae (1,2). An alternative identification would be Erysiphe euphorbiae; however, there are no available mitosporic descriptions for morphological comparisons (1,2). In the United States, powdery mildew of poinsettia previously has been reported in various states in the Pacific Northwest, Midwest, and Northeast. References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN.

Download Full-text

First Report of Powdery Mildew Caused by Golovinomyces cichoracearum on Crotalaria juncea (‘Tropic Sun’ Sunn hemp)

Plant Disease ◽

10.1094/pdis-93-4-0427a ◽

2009 ◽

Vol 93 (4) ◽

pp. 427-427 ◽

Cited By ~ 4

Author(s):

A. J. Gevens ◽

G. Maia ◽

S. A. Jordan

Keyword(s):

United States ◽

Powdery Mildew ◽

Cover Crop ◽

Morphological Characteristics ◽

The United States ◽

Universal Primers ◽

Crotalaria Juncea ◽

First Report ◽

Golovinomyces Cichoracearum ◽

Sunn Hemp

Crotalaria juncea L. (Fabaceae), commonly known as sunn hemp, is a subtropical annual legume grown in the United States as a cover crop that improves soil quality, provides nitrogen, suppresses weeds and nematodes, and adds organic matter to soils. In Florida, sunn hemp is a warm- and short-season cover crop that is typically planted in June and cut and incorporated into soil in September. In 2008, powdery mildew was observed on sunn hemp in a research field in Hastings, FL. This disease is important because it has the potential to impact the health and quality of sunn hemp, and this particular powdery mildew can infect cucurbits that are grown in north Florida from late summer to fall. Fungal growth appeared as typical white, powdery mildew colonies initially seen on upper leaf surfaces, especially along the midvein of infected leaves, but moving to undersides as disease progressed; petioles and floral parts were disease free. As disease progressed, colonies enlarged and coalesced to cover the entire leaf surface; heavily infected leaves senesced and abscised. Infection was primarily seen on the lower, more mature leaves of plants and not on the top 0.6 m (2 feet) of the plant. Mycelia produced white accumulations of conidiophores and conidia. Hyphae were superficial with papillate appressoria and produced conidiophores with cylindrical foot cells that measured 48.5 × 10.0 μm (mean of 100 foot cell measurements) and short chains of conidia. Conidia were hyaline, short-cylindrical to ovoid, lacked fibrosin bodies, borne in chains, had sinuate edge lines with other immature conidia, and measured 22.5 to 40.0 (mean = 29.85 μm) × 12.5 to 20.0 μm (mean = 15.55 μm). The teleomorph was not observed. The nuclear rDNA internal transcribed spacer (ITS) regions were amplified by PCR, using universal primers ITS1 and ITS4, and sequenced (GenBank Accession No. FJ479803). On the basis of morphological characteristics of the asexual, imperfect state that are consistent with published reports of Golovinomyces cichoracearum (2) and ITS sequence data that indicated 100% homology with G. cichoracearum from Helianthus annus (GenBank Accession No. AB077679), this powdery mildew was identified as caused by G. cichoracearum of the classification Golovinomyces Clade III (3). Pathogenicity was confirmed by gently pressing disease leaves onto leaves of healthy C. juncea plants. Inoculated plants were placed into plastic bags containing moist paper towels to maintain high humidity. The temperature was maintained at 24°C, and after 2 days, powdery mildew colonies developed in a manner consistent with symptoms observed under field conditions. A powdery mildew on Crotalaria was previously identified as caused by Microsphaera diffusa Cooke & Peck (1). To our knowledge, this is the first report of G. cichoracearum causing powdery mildew on C. juncea. References: (1) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN, 1989. (2) D. A. Glawe et al. Online publication. doi: 10.1094/PHP-2006-0405-01-BR. Plant Health Progress, 2006. (3) S. Takamatsu et al. Mycol. Res. 110:1093, 2006.

Download Full-text