scholarly journals First Report of Blight on Buxus spp. Caused by Cylindrocladium buxicola in Belgium

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1539-1539 ◽  
Author(s):  
C. Crepel ◽  
S. Inghelbrecht
Keyword(s):  
Control Plant ◽  
First Record ◽  
Leaf Spots ◽  
Laboratory Bench ◽  
Buxus Sempervirens ◽  
Similar Disease ◽  
Stems And Leaves ◽  
Blight Disease ◽  
Stem Lesions ◽  
Made In

In the fall of 2000, a new blight disease was observed on Buxus spp. in private gardens in Belgium. Since then, more and similar disease samples from other Belgian sites, nurseries, and several garden centers have been received, indicating that this disease is spreading. Similar observations have been made in the U.K. and France, where the disease is widespread and losses are sometimes dramatic (1). Diseased plants have dark brown-to-black leaf spots and streaky, black stem lesions which lead, in some cases, to complete defoliation. On some infected plants new leaves grew in defoliated areas, hiding the original blight symptoms. Infection was mainly observed on Buxus sempervirens cv. Suffruticosa, but B. sempervirens cv. Latifolia raculata, B. microphylla cv. Compacta, and B. microphylla var. japonica cv. Faulkner were also infected. In the U.K., infections have additionally been reported on varieties of B. sempervirens, B. sinica, and B. microphylla (1). On the basis of observed symptoms and comparison of the symptoms with descriptions by Henricot and Culham (2), we identified that this new form of Buxus blight in Belgium is caused by Cylindrocladium buxicola. Sporulating cultures on potato dextrose agar (PDA) had macroconidiophores with stipe extensions terminating in broadly ellipsoidal vesicles with pointed or papillate apices (6.5 to 11 μm in diameter) and a penicillate arrangement of fertile branches each terminating in two to five phialides. Phialides produced clusters of cylindrical conidia (42 to 68 × 4 to 6 μm) that were rounded at both ends and had a single septum. Pathogenicity of the isolate was demonstrated by inoculation of healthy stems and leaves of four 3-year-old plants of B. sempervirens cv. Suffruticosa. On each plant, agar pieces of 1-week-old cultures grown on PDA were placed on five stems and five leaves that had been wounded with a sterile scalpel, then sealed with Parafilm. As a control, five wounded stems and leaves from another B. sempervirens cv. Suffruticosa plant were inoculated with sterile agar plugs. Inoculated plants were incubated in humid chambers (approximately 95% relative humidity) on the laboratory bench. Two weeks after inoculation, no symptoms were visible on the control plant. The inoculated plants showed symptoms as previously described, and C. buxicola was successfully reisolated from diseased tissue completing Koch's postulates. To our knowledge, this is the first record of C. buxicola on Buxus spp. in Belgium. References: (1) B. Henricot et al. Plant Pathol. 49:805, 2000. (2) B. Henricot and A. Culham. Mycologia 94(6):980, 2002.

scholarly journals First Record of the Perfect Stage Calonectria pauciramosa on Mastic Tree in Italy

Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 328-328 ◽  
Author(s):  
A. Vitale ◽  
G. Polizzi
Keyword(s):  
South African ◽  
First Record ◽  
Crown Rot ◽  
Natural Occurrence ◽  
Damping Off ◽  
Perfect Stage ◽  
Leaf Spots ◽  
Leaf Tissues ◽  
Plant Pathol ◽  
Stem Lesions

Leaf spots, stem lesions, crown rot, and root rot, caused by heterothallic fungus Cylindrocladium pauciramosum C.L. Schoch & Crous,, on young plants in a nursery represent an important problem in many representative ornamental plant-growing areas of Italy since the disease was first reported in 1993 (2). Symptoms observed during surveys in Italy from 1993 to 2005 were attributed solely to the asexual stage, and the teleomorph (Calonectria pauciramosa C.L. Schoch & Crous) was never found. In October 2005, orange-to-red brown fungal fruiting bodies pertaining to the genus Calonectria were observed in belowground regions and at the soil line on collar and stem tissues of seedlings of the mastic tree (Pistacia lentiscus L., Anacardiaceae) affected by damping off in two nurseries of eastern Sicily. The sexual structures were solitary or in groups, orange-to-red brown, subglobose to ovoid. On the basis of 50 microscopic observations of leaf tissues, they ranged from 180 to 280 μm in diameter and from 270 to 400 μm high. In the presence of adequate moisture, ascospores were discharged from mature perithecia in visible, viscous, and white droplets. Asci containing eight ascospores were clavate and tapering to a long thin stalk. Fusoid ascospores were hyaline and guttulate with rounded ends, slightly curved, 1-septate, not or slightly constricted at the septum, and measured 33 to 39 μm long and 6 to 8 μm wide. However, measurements show that perithecia, asci, and ascospores also fall within the range described by Schoch et al. (3). Single ascospore cultures did not produce perithecia. On the basis of these descriptions and the ability of single-ascospore cultures to mate with two Italian (DISTEF-G87 and DISTEF-G128) and two South African (STE-U 971 and STE-U 1670) selected tester strains of Cylindrocladium pauciramosum (2), the perithecia were identified as C. pauciramosa. To our knowledge, this is the first natural occurrence of the perfect stage of Cylindrocladium pauciramosum in Italy. The presence of the teleomorph is very important because it represents a second means of spread after conidia. Furthermore, the occurrence of the teleomorph also could lead to a 1:1 mating type ratio. In this case, lower percentages of hermaphrodites should be expected (1,4). References: (1) G. Polizzi et al. J. Plant Pathol. 80:262, 1998. (2) G. Polizzi and P. W. Crous. Eur. J. Plant Pathol. 105:413, 1999. (3) C. L. Schoch et al. Mycologia 91:286, 1999. (4) C. L. Schoch et al. Plant Dis. 85:941, 2001.

scholarly journals First Report of Leaf Spots on Laurus nobilis Caused by Phytophthora citricola in Belgium

Plant Disease ◽  
2005 ◽  
Vol 89 (1) ◽  
pp. 107-107 ◽  
Author(s):  
C. Crepel ◽  
S. Inghelbrecht ◽  
S. Baeyen ◽  
M. Maes ◽  
S. G. Bobev
Keyword(s):  
Control Plant ◽  
Morphological Characteristics ◽  
First Record ◽  
Laurus Nobilis ◽  
5.8S Rdna ◽  
Rdna Its2 ◽  
Leaf Spots ◽  
Brown Leaf ◽  
Phytophthora Citricola ◽  
Positive Results

Laurus nobilis (laurel tree) is used as an herbal and ornamental tree in gardens in Belgium. During the summer of 2001, a serious outbreak of leaf spots was observed in some Belgian nurseries. Symptoms were large, irregular, brown leaf spots located primarily on the distal half of leaves and delimited by a black margin. As the disease progressed, the spots enlarged, coalesced, and finally led to leaf withering. The isolated fungus had morphological characteristics typical of Phytophthora citricola. On potato dextrose agar (PDA) it formed white, entire rosette colonies. Within 1 week, semipapillate sporangia were found abundantly in water at room temperature. They were mostly ovoid and highly variable in size (20 to 82 × 12 to 48 µm). The sporangial apex was broadly papillate. Oogonia were spherical (18 to 38 µm in diameter), and the antheridia were paragynous. Pathogenicity of the isolated fungus was confirmed by inoculating two visibly healthy L. nobilis plants. Five leaves per plant were wounded by a scalpel, subsequently inoculated with 5-mm-diameter mycelial plugs on PDA, and sealed with Parafilm. As a control, noncolonized agar plugs were placed on wounded leaves from a third L. nobilis plant. The inoculated plants and the control plant were kept for 1 day under a plastic cover (approximately 95% relative humidity) on the laboratory bench. Within 1 week, all inoculated leaves developed symptoms, whereas the control leaves remained symptomless. P. citricola was sucessfully re-isolated, satisfying Koch's postulates. The pathogen was also characterized using molecular tools. The ribosomal DNA regions, ITS1 and 5.8S rDNA-ITS2, were sequenced and highest similarity scores were obtained with corresponding Phytophthora citricola sequence regions (>99% identity for both sequences). The new GenBank Accession Nos. are AY525786 (ITS1) and AY525787 (5.8S rDNA-ITS2). On the basis of the symptoms, cultural and morphological characteristics, and positive results in pathogenicity and PCR tests, the isolate was considered to be P. citricola. To our knowledge, this is the first record of P. citricola on leaves of L. nobilis in Belgium.

scholarly journals Fungicidal management of Alternaria alternata (Fr.) Keissler causing blight of gerbera (Gerbera jamesonii H. Bolus ex J.D. Hook)

2012 ◽  
Vol 4 (2) ◽  
pp. 220-227 ◽  
Author(s):  
Dipak T. Nagrale ◽  
Anil P. Gaikwad ◽  
Sanjay Goswami ◽  
Lalan Sharma
Keyword(s):  
Disease Management ◽  
Disease Control ◽  
Alternaria Alternata ◽  
Fungal Pathogen ◽  
Management Practices ◽  
Bordeaux Mixture ◽  
Gerbera Jamesonii ◽  
Leaf Spots ◽  
Aerial Parts ◽  
Blight Disease

Alternaria, the fungal pathogen has wide host range generally attacks the aerial parts of plants causing leaf spots and blights. Gerbera is a genus of ornamental flower plants. Gerbera plants are infected by many diseases. Different disease management practices are adopted in gerbera cultivation. The fungicidal management of Alternaria blight is one of the important strategies for the disease management in gerbera in polyhouse condition. In this study, preventive and curative fungicidal sprays were adopted for the management of blight disease in polyhouse. This study revealed that preventive fungicidal sprays were significant over curative fungicidal sprays for the management of Alternaria alternata blight of gerbera (Gerbera jamesonii H. Bolus ex J.D. Hook) in polyhouse. The preventive sprays made of Bordeaux mixture (0.6 %), tricyclazole (0.1%) and iprodione + carbendazim (0.1%) fungicides were found effective with 95.85 %, 96.59 % and 95.88 % disease control respectively, under polyhouse condition.

scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

scholarly journals First Report of Box Blight Caused by Cylindrocladium pseudonaviculatum (C. buxicola) in British Columbia, Canada

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 559-559 ◽  
Author(s):  
J. F. Elmhirst ◽  
B. E. Auxier ◽  
L. A. Wegener
Keyword(s):  
British Columbia ◽  
Room Temperature ◽  
Its Region ◽  
Host Tissue ◽  
Green Mountain ◽  
Single Spore ◽  
Black Water ◽  
Leaf Spots ◽  
Buxus Sempervirens ◽  
Fraser Valley

Boxwoods (Buxus spp.) are common woody ornamental hedging plants in Europe and North America, typically propagated by cuttings. In October 2011, shoot dieback and defoliation was observed on Buxus sempervirens ‘Suffruticosa’ (dwarf English boxwood) and ‘Green Balloon’ in outdoor, 10-cm pots at a wholesale nursery in Chilliwack, British Columbia. Circular leaf spots with black rings occurred on leaves and black, water-soaked, cankers girdled the stems and petioles. Leaf and stem samples were collected on November 21, 2011, and incubated for 48 h in a moist chamber at room temperature. In addition to Volutella buxi, a Cylindrocladium species producing conidia on white sporodochia was observed on host tissue under the microscope. Leaves with lesions were surface-sterilized in 10% bleach for 30 to 60 s, rinsed in sterile water, and lesions were cut out and plated on PDA and carnation leaf media. The species was identified as Cylindrocladium pseudonaviculatum Crous, J.Z. Groenew. & C.F. Hill 2002 by comparison of conidia and phialide morphology to published descriptions. Conidia were hyaline, one-septate, cylindrical with rounded ends and 38 to 76 μm (mean 51 μm) × 4 to 6 μm on carnation leaf media and 41 to 66 μm (mean 52 μm) × 4 to 6 μm on B. sempervirens ‘Suffruticosa’ leaves, comparable to the reported range of 40 to 75 × 4 to 6 μm (1,2,3,4). Conidia were produced in clusters on terminal, ellipsoid vesicles at the tips of penicillate conidiophores. Vesicles were 10.2 (7.6 to 12.8 μm) at the widest point, consistent with the 6 to 11 μm reported in (2,3) and tapered to a rounded point; stipe extensions were septate and measured an average of 130 μm (107 to 163 μm) in length to the tip of the vesicle, consistent with the 95 to 155 μm reported in (1), 89 to 170 μm reported in (2), and 95 to 165 μm in (3). Chlamydospores were not observed on host tissue but appeared in older PDA cultures as dark brown microsclerotia. DNA was extracted from single-spore colonies on PDA and the internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS1 and ITS4. The ITS sequence (GenBank Accession No. KC291613) was 100% identical to C. buxicola strain CB-KR001 (HM749646.1) and Calonectria pseudonaviculata strain ATCC MYA-4891 (JX174050.1). In early December 2011, box blight was identified on container-grown B. sinica var. insularis × B. sempervirens ‘Green Velvet,’ ‘Green Gem’, and ‘Green Mountain’ and B. sempervirens L. (common or American boxwood). The pathogen was identified by microscopic examination at three wholesale nurseries in the eastern Fraser Valley and one landscape planting. The isolate has been deposited in the Canadian Collection of Fungal Cultures in Ottawa, Canada (DAOM 242242). References: (1) B. Henricot and A. Culham. Mycologia 94:980, 2002. (2) K. L. Ivors, et al. Plant Dis. 96:1070, 2012. (3) C. Pintos Varela, et al. Plant Dis. 93:670, 2009. (4) M. Saracchi, et al. J. Plant Pathol. 90:581, 2008.

A NOTE ON THE OCCURRENCE OF COLEOPHORA FRISCHELLA (LEPIDOPTERA: COLEOPHORIDAE) IN NORTH AMERICA

1967 ◽  
Vol 99 (11) ◽  
pp. 1229-1229 ◽  
Author(s):  
P. G. Pilley ◽  
R. A. Trieselmann
Keyword(s):  
United States ◽  
North America ◽  
Personal Communication ◽  
First Record ◽  
The United States ◽  
Sweet Clover ◽  
Economic Significance ◽  
Melilotus Alba ◽  
St Lawrence River ◽  
Made In

The first record of the occurrence in North America of the white-tipped clover case-moth, Coleophora frischella L., was made in June 1966 when a single adult was taken by Heinemann on Picton Island, N.Y., in the St. Lawrence River (Freeman, personal communication). Independently, Trieselmann collected the larvae from white sweet-clover, Melilotus alba Desr., on 28 July through to 8 August 1966 at many points around Pembroke, Ont. Detailed examinations made at two of the collection points indicated that between 15 and 20% of sweetclover seeds were damaged. Because of its potential economic significance, the authors wish to make the presence of this species known to agricultural entomologists in Canada and the United States.

Note on Two Species of Leafhoppers (Homoptera: Cicadellidae) New to Canada

1959 ◽  
Vol 91 (4) ◽  
pp. 253-253
Author(s):  
J. A. George
Keyword(s):  
United States ◽  
First Record ◽  
The United States ◽  
Japanese Species ◽  
Niagara River ◽  
Made In

Three specimens of a species of leafhopper new to the Niagara Peninsula were collected during 1956 along the wooded bank of Niagara River below Queenston, Ontario; they were identified by Mrs. C. J. Williams, Entomology Division, Ottawa, as Orientus ishidae (Mat.) and are in the Canadian National Collection. According to Oman (1949), this is an introduced Japanese species which lives on willow and is widely distributed. Presumably Oman's statement is based on collections made in the United States as Mrs. Williams stated (in litt.) that this was the first record from Canada.

scholarly journals Prevalence and intensity of infection by Raillietiella gigliolii Hett, 1924 (Pentastomida) in Amphisbaena alba Linnaeus, 1758 and A. vermicularis Wagler, 1824 (Amphisbaenidae) from Northeastern Brazil

2009 ◽  
Vol 69 (4) ◽  
pp. 1183-1186 ◽  
Author(s):  
WO. Almeida ◽  
DL. Sales ◽  
GG. Santana ◽  
WLS. Vieira ◽  
SC. Ribeiro ◽  
...  
Keyword(s):  
Atlantic Forest ◽  
Parasite Species ◽  
First Record ◽  
Northeastern Brazil ◽  
Ecological Data ◽  
Intensity Of Infection ◽  
Humid Forest ◽  
Mean Intensity ◽  
Determinant Factor ◽  
Made In

Raillietiella gigliolii is a Neotropical pentastomid parasite found in Amphisbaena alba. Collections were made in northeastern Brazil in a remnant area of Atlantic Forest (07º 10' S and 35º 05' W) in the municipality of Cruz do Espírito Santo, Paraíba State, and in a Humid Forest area (07º 16' S and 39º 26' W) on the slopes of the Chapada do Araripe Mountains, municipality of Crato, Ceará state, Brazil. Nine specimens of A. alba and 12 of A. vermicularis were collected to gather basic ecological data (prevalence and mean intensity of infection) concerning these parasites. Raillietiella gigliolii was found infecting the lungs of both species. The prevalence for A. alba was 55.5% (5/9), with a mean intensity of infection of 5.0 ± 2.53 and amplitudes of 1-13. A. vermicularis demonstrated prevalence of 50%, with a mean intensity of infection of 5.3 ± 2.1 and amplitudes of 1-14. This represents the first record of R. gigliolii as a parasite of A. vermicularis. Our results suggest that R. gigliolii is a generalist parasite species and that an overlapping diet is the determinant factor in the sharing of its final hosts.

Sign in / Sign up

Export Citation Format

Share Document