scholarly journals First Report of the Causal Agent of Huanglongbing (“Candidatus Liberibacter asiaticus”) in Brazil

Plant Disease ◽  
2004 ◽  
Vol 88 (12) ◽  
pp. 1382-1382 ◽  
Author(s):  
H. D. Coletta-Filho ◽  
M. L. P. N. Targon ◽  
M. A. Takita ◽  
J. D. De Negri ◽  
J. Pompeu ◽  
...  
Keyword(s):  
Polymerase Chain Reaction Amplification ◽  
The Philippines ◽  
Sao Paulo ◽  
The State ◽  
Nutritional Deficiencies ◽  
São Paulo ◽  
Candidatus Liberibacter Asiaticus ◽  
First Report ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

Huanglongbing (ex-greening) disease is one of the most serious diseases of citrus. It is caused by the phloem-limited, gram-negative bacterium “Candidatus Liberibacter spp.”. This bacterium is not well characterized mainly because it is still uncultured. There are two known strains, Asian (“Candidatus Liberibacter asiaticus”) and African (“Candidatus Liberibacter africanus”) that cause severe damage to citrus plants including twig dieback, decline, and death. Symptoms first appear as leaf mottling and chlorosis occurring in one shoot or sector of trees. Later, leaf symptoms resemble nutritional deficiencies (Zn, Ca, and N) that vary depending on the strains, with more severe symptoms caused by “Ca. L. asiaticus”. The Asian strains are transmitted by the Asian citrus psyllid (AsCP), Diaphorina citri, which is present in Brazil. The bacterium has been detected in citrus plants in many geographic locations including China, Japan, Thailand, India, the Philippines, the Arabian Peninsula, and Africa. In 2004, plants showing Huanglongbing symptoms were observed in the Araraquara County, a central region of the State of Sao Paulo, the largest citrus-producing area in Brazil. To verify the presence of “Ca. L. spp.” in these plants, leaf samples of sweet orange cvs. Hamlin and Valencia were used for DNA extraction and polymerase chain reaction amplification using the specific OI1 and Oi2c primers (1). Amplification of the 16S rDNA was positive for 2 (cvs. Hamlin and Valencia) of 10 analyzed plants. The amplified fragments were cloned and sequenced. The amplicons obtained from both plants showed the same sequence, which differed from “Ca. L. africanus”, utilized as the positive control in the amplification experiment (27 divergent bases in 1,160). The sequences were used for BLAST searches, and the results showed identities ranging from 94.71 to 100% with “Ca. L. spp.” sequences available at the National Center for Biotechnology Information database (on-line publication). The highest scores were obtained with “Ca. L. asiaticus sequences. These analyses confirmed the presence of such agent in the State of Sao Paulo. To our knowledge, this is the first report of “Ca. L. asiaticus” in Brazil as well as elsewhere in the Americas. The significance of this report relates to the potential damage that this pathogen could cause to the citrus industry in the largest citrus-producing country in the world. It remains unclear how and when the pathogen entered Brazil. Reference: (1) S. Jagoueix et al. Mol. Cell Probes 10:43, 1996.

scholarly journals Liberibacters Associated with Citrus Huanglongbing in Brazil: ‘Candidatus Liberibacter asiaticus’ Is Heat Tolerant, ‘Ca. L. americanus’ Is Heat Sensitive

Plant Disease ◽  
2009 ◽  
Vol 93 (3) ◽  
pp. 257-262 ◽  
Author(s):  
S. A. Lopes ◽  
G. F. Frare ◽  
E. Bertolini ◽  
M. Cambra ◽  
N. G. Fernandes ◽  
...  
Keyword(s):  
Sweet Orange ◽  
Sao Paulo ◽  
São Paulo ◽  
Candidatus Liberibacter Asiaticus ◽  
Paulo State ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
São Paulo State ◽  
Heat Tolerant ◽  
Orange Trees

In São Paulo State, Brazil, ‘Candidatus Liberibacter americanus’ and ‘Candidatus Liberibacter asiaticus’ are associated with huanglongbing (HLB). Affected municipalities occur mainly in the central and southern regions, where the annual number of hours above 30°C is two to five times lower than that in the extreme northern and western regions. The influence of temperature on sweet orange trees infected with ‘Ca. L. asiaticus’ or ‘Ca. L. americanus’ was studied in temperature-controlled growth chambers. Symptom progression on new shoots of naturally infected and experimentally graft-inoculated symptomatic sweet orange trees was assessed. Mottled leaves developed on all infected trees at 22 to 24°C, but not on any ‘Ca. L. americanus’–infected trees at 27 to 32°C. Quantitative, real time-PCR was used to determine the liberibacter titers in the trees. After 90 days, ‘Ca. L. asiaticus’–infected trees had high titers at 32 and 35°C, but not at 38°C, while ‘Ca. L. americanus’–infected trees had high titers at 24°C, but at 32°C the titers were very low or the liberibacters could not be detected. Thus, the multiplication of ‘Ca. L. asiaticus’ is not yet affected at 35°C, while a temperature of 32°C is detrimental to ‘Ca. L. americanus’. Thus, ‘Ca. L. americanus’ is less heat tolerant than ‘Ca. L. asiaticus’. The uneven distribution of these two liberibacters in São Paulo State might be in relation with these results.

scholarly journals First report of ‘Candidatus Liberibacter asiaticus’ in Diaphorina communis

2011 ◽  
Vol 7 (1) ◽  
pp. 1-4 ◽  
Author(s):  
N. J. Donovan ◽  
G. A. C. Beattie ◽  
G. A. Chambers ◽  
P. Holford ◽  
A. Englezou ◽  
...  
Keyword(s):  
Candidatus Liberibacter Asiaticus ◽  
First Report ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

scholarly journals Rhizopogon (Rhizopogonaceae): hypogeous fungi in exotic plantations from the State of São Paulo, Brazil

2002 ◽  
Vol 16 (1) ◽  
pp. 55-59 ◽  
Author(s):  
Iuri Goulart Baseia ◽  
Adauto Ivo Milanez
Keyword(s):  
Sao Paulo ◽  
The State ◽  
São Paulo ◽  
Hypogeous Fungi ◽  
First Report ◽  
Exotic Trees ◽  
Exotic Plantations

A survey on the genus Rhizopogon, associated with roots of exotic trees in State of São Paulo (Brazil), was undertaken from January /1999 to September/2000. Three species were identified: R. luteolus Fr., R. roseolus Corda sensu A. H. Smith and R. rubescens Tul. This is the first report of R. luteolus and R. roseolus from Brazil.

scholarly journals First report on molecular evidence of Candidatus Liberibacter asiaticus associated with citrus Huanglongbing in Venezuela

2020 ◽  
Vol 102 (4) ◽  
pp. 1333-1333
Author(s):  
Edgloris Marys ◽  
Eduardo Rodríguez-Román ◽  
Rafael Mejías ◽  
Alexander Mejías ◽  
Mailyn Mago ◽  
...  
Keyword(s):  
Molecular Evidence ◽  
Candidatus Liberibacter Asiaticus ◽  
First Report ◽  
Candidatus Liberibacter ◽  
Citrus Huanglongbing ◽  
Liberibacter Asiaticus

scholarly journals Distribution of Candidatus Liberibacter species in Eastern Africa, and the First Report of Candidatus Liberibacter asiaticus in Kenya

2020 ◽  
Vol 10 (1) ◽  
Author(s):  
Inusa J. Ajene ◽  
Fathiya M. Khamis ◽  
Barbara van Asch ◽  
Gerhard Pietersen ◽  
Nurhussen Seid ◽  
...  
Keyword(s):  
Eastern Africa ◽  
Candidatus Liberibacter Asiaticus ◽  
First Report ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

scholarly journals First report of a NDM-producing Providencia rettgeri strain in the state of São Paulo

2015 ◽  
Vol 19 (6) ◽  
pp. 675-676 ◽  
Author(s):  
Nelson Vieira do Carmo Junior ◽  
Heli Ferreira Filho ◽  
Durval Alex Gomes e Costa ◽  
Adilson Joaquim Westheimer Calvalcante ◽  
Doroti de Oliveira Garcia ◽  
...  
Keyword(s):  
Sao Paulo ◽  
The State ◽  
São Paulo ◽  
Providencia Rettgeri ◽  
First Report

scholarly journals First Report of ‘Candidatus Liberibacter asiaticus’ Associated with Huanglongbing on Citrus latifolia in Martinique and Guadeloupe, French West Indies

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 683-683 ◽  
Author(s):  
G. Cellier ◽  
A. Moreau ◽  
N. Cassam ◽  
B. Hostachy ◽  
P. Ryckewaert ◽  
...  
Keyword(s):  
West Indies ◽  
Plant Protection ◽  
The United States ◽  
Nutrient Deficiencies ◽  
Candidatus Liberibacter Asiaticus ◽  
Protein Subunit ◽  
French West Indies ◽  
First Report ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus

Huanglongbing is an unculturable vascular citrus pathogen transmitted from infected to healthy plants through grafting or by citrus psyllids, Diaphorina citri mainly in Asia and America and Trioza erytreae in Africa. This phloem limited gram-negative bacterium causes dramatic yield losses and is classified into three species based on 16S rDNA sequence analysis (2): (i) ‘Candidatus Liberibacter asiaticus’ (Las), the most epidemiologically active, widespread and heat tolerant species; (ii) ‘Ca. L. africanus’ (Laf), only found in Africa; and (iii) the newly described ‘Ca. L. americanus’ (Lam), which appeared in 2005 in Brazil (5). Considered as a quarantine organism in America and Europe, Las is actively affecting North America and Asia, and research is leading toward psyllid management and resistance breeding. Despite the fact that Reunion Island has successfully controlled Las by introducing a psyllid parasitoid, Tamarixia radiata (1), this strategy was less effective or reproducible within other territories. D. citri was first detected in Guadeloupe in 1998, where the control of the the psyllid population has been effective with T. radiata (3); and was first detected in Martinique in 2012. Following the outbreak in the United States and the Caribbean, and also supported by reports of symptoms in citrus orchards, local National Plant Protection Organizations (NPPO) organized a detection survey across both islands to verify the occurrence of Huanglongbing. Since 2012, 450 sites were prospected each year in Martinique and Guadeloupe, where 20 leaves from 10 to 30 trees were analyzed. DNA extraction was performed (DNeasy Plant Mini Kit, Qiagen) on fresh or dried leaf midribs, along with negative control midribs (Citrus paradisi ‘Star Rubis’) and PCR amplification was done with the species-specific primers A2/J5 (4) and GB1/GB3 (5). Only Las-specific 703-bp amplicons were obtained (n = 43) and 20 were sequenced (Beckman Coulter Genomics, United Kingdom; sequences available through GenBank Accession Nos. KF699074 to KF699093) and blasted against the National Center for Biotechnology Information non-redondant database (NCBI-nr). BLAST analysis revealed 100% identity with the 50S ribosomal protein subunit L1 (rplA) and L10 (rplJ) of ‘Ca. L. asiaticus’ (all strains), and no significant homology to other organisms. Additionally, sequence assembly on a reference genome (NC_012985) showed 100% homology. Huanglongbing was detected in Guadeloupe on March 2012 at Le Moule (East coast) in a Tahiti lime orchard (C. latifolia) and crossed the island in 6 months. Las was detected in Martinique on May 2013 on Tahiti lime (C. latifolia) at Bellefontaine (Northwest) in a private garden and at Le Lorrain (Northeast) in an orchard. Other species from the Rutaceae family were affected by HLB (C. reticulat and C. sinensis) on both islands; however, few of the positive samples showed HLB symptoms (blotchy mottle patterns and green islands on leaves), but presented symptoms similar to nutrient deficiencies. Despite the former presence of T. radiata in Guadeloupe and its detection in Martinique a few weeks after the detection of D. citri, where it had a mean parasitism rate of 70%, an outbreak of HLB spread across both islands. These analyses confirm the presence of HLB in Martinique and Guadeloupe and to our knowledge represent the first report of Las in the French West Indies. Introduction events remain unclear, but this report raises the importance of plant certification, psyllid population control, and surveillance of territories close to the French West Indies, with regards to the risk that HLB presents to citrus production worldwide. References: (1) B. Aubert et al. Fruits. 38, 1983. (2) J. M. Bové. J. Plant Pathol. 88:1, 2006. (3) J. Etienne et al. Fruits. 56:05, 2001. (4) A. Hocquellet et al. Mol. Cell. Probes 13:5, 1999. (5) D. C. Teixeira et al. Mol. Cell. Probes 19:3, 2005.

scholarly journals Root-Knot Disease Caused by Meloidogyne arenaria and M. javanica in Teak in São Paulo State, Brazil

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 151-151
Author(s):  
J. V. de Araújo Filho ◽  
A. C. Z. Machado ◽  
R. S. C. A. de Faria ◽  
L. E. A. Camargo
Keyword(s):  
Sao Paulo ◽  
The State ◽  
Meloidogyne Arenaria ◽  
São Paulo ◽  
Mato Grosso ◽  
Lateral Field ◽  
First Report ◽  
Paulo State ◽  
São Paulo State ◽  
Esterase Phenotypes

Teak (Tectona grandis Linn. F.) is one of the most important forest crops in Brazil, occupying areas in different regions, such as Goiás, Mato Grosso, Paraná, and São Paulo states. Teak wood is used for many purposes such as shipbuilding, rolling and plywood, firewood, and charcoal. In May 2011, teak symptomatic feeder root samples, exhibiting inconspicuous, small galls, were collected in the municipality of Piracicaba, São Paulo State, Brazil (22°41′46.90″S, 47°38′36.84″W). Specimens were identified through perineal patterns and esterase phenotypes of 20 adult females (1,2). Perineal patterns and esterase phenotypes were consistent with those described for Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 and M. javanica (Treub, 1885) Chitwood, 1949. Perineal patterns of M. arenaria showed a low dorsal arch, compressed dorsolaterally, with lateral field marked by some forked and broken striae; no punctate markings between anus and tail terminus were observed. Perineal patterns of M. javanica were rounded, with low dorsal arch, striae smooth, lateral field distinct, clearly demarcated from striae by parallel lines. From the esterase electrophoresis we obtained A2 (Rm:1.2;1.3) and J3 (Rm:1.0;1.25;1.4) phenotypes, typical from M. arenaria and M. javanica, respectively. To our knowledge, this is the first report of M. arenaria parasitizing teak roots in Brazil and elsewhere (new host) and the first report of M. javanica infecting teak in the State of São Paulo. Previously, M. javanica was reported to be infecting teak-growing areas in the State of Mato Grosso (3). This finding has a great importance, not only by the inclusion of these parasites in teak pathological scenario, but also for predicting possible damage in plant species used in teak-based intercropping systems. References: (1) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (2) K. M. Hartman and J. N. Sasser. 1985. Page 115 in: An Advanced Treatise on Meloidogyne. Volume II, Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh,1985. (3) R. A. Silva et al. Nematol. Bras. 27:261, 2003.

scholarly journals First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan

Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 448-448 ◽  
Author(s):  
Y. S. Ahlawat ◽  
V. K. Baranwal ◽  
Thinlay ◽  
Doe Doe ◽  
S. Majumder
Keyword(s):  
Citrus Greening ◽  
Ribosomal Protein Genes ◽  
Candidatus Liberibacter Asiaticus ◽  
African Countries ◽  
First Report ◽  
Citrus Greening Disease ◽  
Pcr Product ◽  
Candidatus Liberibacter ◽  
Liberibacter Asiaticus ◽  
Greening Disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Sign in / Sign up

Export Citation Format

Share Document