scholarly journals Pathogenicity of a naturally occurring recombinant DNA satellite associated with tomato yellow leaf curl China virus

2008 ◽  
Vol 89 (1) ◽  
pp. 306-311 ◽  
Author(s):  
Xiaorong Tao ◽  
Xueping Zhou
Keyword(s):  
Petunia Hybrida ◽  
Recombinant Dna ◽  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Nicotiana Glutinosa ◽  
Naturally Occurring ◽  
Infected Tobacco ◽  
Leaf Curl

Recombinant DNA β molecules (RecDNA-Aβ) comprising parts of DNA A and DNA β associated with tomato yellow leaf curl China virus (TYLCCNV) have been identified in naturally infected tobacco plants. Several examples of the recombinant DNA have been cloned and characterized by sequence analysis. All are approximately half the size of TYLCCNV genomic DNA, and all contain the βC1 gene and the A-rich region from TYLCCNV DNA β as well as intergenic region sequences and the 5′ terminus of the AC1 gene from TYLCCNV DNA A. RecDNA-Aβ was detected by PCR in five of 25 TYLCCNV isolates. Co-inoculation of TYLCCNV DNA A and RecDNA-Aβ induced symptoms indistinguishable from those induced by TYLCCNV DNA A and DNA β in Nicotiana benthamiana, Nicotiana glutinosa, Solanum lycopersicum and Petunia hybrida plants, and Southern blot hybridization results showed that RecDNA-Aβ could replicate stably in N. benthamiana plants.

scholarly journals A DNAβ Associated with Tomato Yellow Leaf Curl China Virus Is Required for Symptom Induction

2004 ◽  
Vol 78 (24) ◽  
pp. 13966-13974 ◽  
Author(s):  
Xiaofeng Cui ◽  
Xiaorong Tao ◽  
Yan Xie ◽  
Claude M. Fauquet ◽  
Xueping Zhou
Keyword(s):  
Transgenic Plants ◽  
Stop Codon ◽  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Cauliflower Mosaic Virus ◽  
Start Codon ◽  
35S Promoter ◽  
Yellow Leaf ◽  
Leaf Curl

ABSTRACT We report here that all 25 isolates of Tomato yellow leaf curl China virus (TYLCCNV) collected from tobacco, tomato, or Siegesbeckia orientalis plants in different regions of Yunnan Province, China, were associated with DNAβ molecules. To investigate the biological role of DNAβ, full-length infectious clones of viral DNA and DNAβ of TYLCCNV isolate Y10 (TYLCCNV-Y10) were agroinoculated into Nicotiana benthamiana, Nicotiana glutinosa, Nicotiana. tabacum Samsun (NN or nn), tomato, and petunia plants. We found that TYLCCNV-Y10 alone could systemically infect these plants, but no symptoms were induced. TYLCCNV-Y10 DNAβ was required, in addition to TYLCCNV-Y10, for induction of leaf curl disease in these hosts. Similar to TYLCCNV-Y10, DNAβ of TYLCCNV isolate Y64 was also found to be required for induction of typical leaf curl diseases in the hosts tested. When the βC1 gene of TYLCCNV-Y10 DNAβ was mutated, the mutants failed to induce leaf curl symptoms in N. benthamiana when coinoculated with TYLCCNV-Y10. However, Southern blot hybridization analyses showed that the mutated DNAβ molecules were replicated. When N. benthamiana and N. tabacum plants were transformed with a construct containing the βC1 gene under the control of the Cauliflower mosaic virus 35S promoter, many transgenic plants developed leaf curl symptoms similar to those caused by a virus, the severity of which paralleled the level of βC1 transcripts, while transgenic plants transformed with the βC1 gene containing a stop codon after the start codon remained symptomless. Thus, expression of a βC1 gene is adequate for induction of symptoms of viral infection in the absence of virus.

scholarly journals Tomato yellow leaf curl virus Can Overwinter in Stellaria aquatica, a Winter-Hardy TYLCV-Reservoir Weed

Plant Disease ◽  
2015 ◽  
Vol 99 (5) ◽  
pp. 588-592 ◽  
Author(s):  
Eui-Joon Kil ◽  
Hee-Seong Byun ◽  
Sunhoo Kim ◽  
Seungchan Cho ◽  
Sungrae Cho ◽  
...  
Keyword(s):  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Plant Viruses ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Greenhouse Production ◽  
Tomato Plants ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), one of the most serious plant viruses in tropical and subtropical regions, is transmitted to host plants by the vector insect Bemisia tabaci. In order to control TYLCV, it is important to identify weed hosts for overwintering TYLCV. Stellaria aquatica, a winter-hardy weed, was found growing with TYLCV-infected tomato plants in greenhouse production. TYLCV was detected in S. aquatica plants by polymerase chain reaction and Southern blot hybridization analysis. The intergenic region nucleotide sequences amplified from TYLCV-infected tomato plants, TYLCV-viruliferous whiteflies, and S. aquatica were identical. During winter (December to February), TYLCV-viruliferous whiteflies and TYLCV-infected tomato plants were removed or absent from greenhouses. However, S. aquatica plants were observed over a period of 10 months from August to May in such greenhouses, and TYLCV was consistently detected in some of these plants. To investigate the transmission of TYLCV from TYLCV-infected S. aquatica plants to healthy tomato plants by whiteflies, TYLCV-infected S. aquatica plants were transplanted to pots in cages with nonviruliferous whiteflies and healthy tomato plants. After 4 weeks, tomato plants developed typical TYLCV disease symptoms, and TYLCV was detected in both whiteflies and tomato plants. These results show that S. aquatica can act as a winter-hardy reservoir for TYLCV, and suggest that this weed could play an important role in overwintering of TYLCV in tomato greenhouses.

scholarly journals Evaluation the efficiency of different techniques for extraction and purification of Tomato yellow leaf curl virus (TYLCV)

2011 ◽  
Vol 8 (1) ◽  
pp. 447-452 ◽  
Author(s):  
Baghdad Science Journal
Keyword(s):  
Incubation Period ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Nicotiana Glutinosa ◽  
Citrate Buffer ◽  
Extraction And Purification ◽  
Standard Value ◽  
Leaf Curl Virus ◽  
White Burley ◽  
Leaf Curl

This study was conducted to evaluate the efficacy of different techniques for extraction and purification of Tomato yellow leaf curl virus (TYLCV). An isolate of the virus free of possible contamination with other viruses infecting the same host and transmitted by the same vector Bemisia tabaci Genn. was obtained. This was realized by indicator plants and incubation period in the vector. Results obtained revealed that the virus infect Nicotiana glutinosa without visible symptoms, while Nicotiana tabaccum var. White Burley was not susceptible to the virus. The incubation period of the virus in the vector was found to be 21 hrs. These results indicate that the virus is TYLCV. Results showed that Butanol was more effective in clarification the sap and eliminate of plant proteins and chlorophyll. The use of citrate buffer at pH 8 amended with reducing agents and EDTA to prevent the oxidation of phenolic compound was found to be suitable in maintaining the biological activity of the virus during extraction. The quantity of the virus obtained was 3.05 mg/100 gm leaves with absorption ratio of 1.4 at 260/280 nm which represent standard value for TYLCV.

Tomato yellow leaf curl virusin Australia: distribution, detection and discovery of naturally occurring defective DNA molecules

2010 ◽  
Vol 39 (5) ◽  
pp. 412 ◽  
Author(s):  
S. L. Van Brunschot ◽  
D. M. Persley ◽  
A. D. W. Geering ◽  
P. R. Campbell ◽  
J. E. Thomas
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Dna Molecules ◽  
Naturally Occurring ◽  
Leaf Curl

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

scholarly journals Virion Stability Is Important for the Circulative Transmission of Tomato Yellow Leaf Curl Sardinia Virus by Bemisia tabaci, but Virion Access to Salivary Glands Does Not Guarantee Transmissibility

2009 ◽  
Vol 83 (11) ◽  
pp. 5784-5795 ◽  
Author(s):  
Piero Caciagli ◽  
Vicente Medina Piles ◽  
Daniele Marian ◽  
Manuela Vecchiati ◽  
Vera Masenga ◽  
...  
Keyword(s):  
Salivary Glands ◽  
Bemisia Tabaci ◽  
Mutational Analysis ◽  
Blot Hybridization ◽  
Trialeurodes Vaporariorum ◽  
Significant Inhibition ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Dot Blot ◽  
Leaf Curl

ABSTRACT The capsid protein (CP) of the monopartite begomovirus Tomato yellow leaf curl Sardinia virus (TYLCSV), family Geminiviridae, is indispensable for plant infection and vector transmission. A region between amino acids 129 and 152 is critical for virion assembly and insect transmissibility. Two previously described mutants, one with a double Q129P Q134H mutation (PNHD) and another with a further D152E change (PNHE), were found nontransmissible (NT). Another NT mutant with a single N130D change (QDQD) was retrieved from a new mutational analysis. In this study, these three NT mutants and the wild-type (wt) virus were compared in their relationships with the whitefly vector Bemisia tabaci and the nonvector Trialeurodes vaporariorum. Retention kinetics of NT mutants were analyzed by quantitative dot blot hybridization in whiteflies fed on infected plants. The QDQD mutant, whose virions appeared nongeminate following purification, was hardly detectable in either whitefly species at any sampling time. The PNHD mutant was acquired and circulated in both whitefly species for up to 10 days, like the wt virus, while PNHE circulated in B. tabaci only. Using immunogold labeling, both PNHD and PNHE CPs were detected in B. tabaci salivary glands (SGs) like the wt virus, while no labeling was found in any whitefly tissue with the QDQD mutant. Significant inhibition of transmission of the wt virus was observed after prior feeding of the insects on plants infected with the PNHE mutant, but not on plants infected with the other mutants. Virion stability and ability to cross the SG barrier are necessary for TYLCSV transmission, but interactions with molecular components inside the SGs are also critical for transmissibility.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Tomato, Tomatillo, and Peppers in Guatemala

Plant Disease ◽  
2010 ◽  
Vol 94 (4) ◽  
pp. 482-482 ◽  
Author(s):  
R. Salati ◽  
M. Shorey ◽  
A. Briggs ◽  
J. Calderon ◽  
M. R. Rojas ◽  
...  
Keyword(s):  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Full Length ◽  
Bipartite Begomovirus ◽  
Yellow Leaf ◽  
Sequence Analyses ◽  
Degenerate Primers ◽  
Begomovirus Infection ◽  
Leaf Curl Virus ◽  
Leaf Curl

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts. References: (1) M. K. Nakhla et al. Acta Hortic. 695:277, 2005. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) R. Salati et al. Phytopathology 92:487, 2002. (4) S. D. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

scholarly journals First report of naturally occurring recombinant non-coding DNA satellite associated with Tomato yellow leaf curl Kanchanaburi virus on eggplant in Indonesia

2019 ◽  
Vol 21 (1) ◽  
Author(s):  
Argawi Kandito ◽  
Sedyo Hartono ◽  
Sri Sulandari ◽  
Susamto Somowiyarjo ◽  
Yepi Arbeta Wdyasari
Keyword(s):  
Pcr Amplification ◽  
Tomato Yellow Leaf ◽  
Begomovirus Species ◽  
Yellow Leaf ◽  
Specific Primer ◽  
Universal Primer ◽  
Stem Loop ◽  
First Report ◽  
Naturally Occurring ◽  
Leaf Curl

Abstract. Kandito A, Hartono S, Sulandari S, Somowiyarjo S, Widyasari YA. 2019. First report of naturally occurring recombinant non-coding DNA satellite associated with Tomato yellow leaf curl Kanchanaburi virus on eggplant in Indonesia. Biodiversitas 20: 129-136. Begomovirus is a viral genus which is a major impediment in the cultivation of plants, especially Solanaceae. Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) is a member of the Begomovirus genus that is widely reported to infect eggplant and results in severe symptoms of chlorosis. In addition to the type of virus that infects, the severity of symptoms can also be caused by the presence of betasatellite associated with several begomovirus species. The presence of betasatellite that is related to several begomovirus species can lead to more severe symptoms. The aim of this study was to identify satellites associated with begomovirus in Indonesia. Eggplant samples from Bantul, Special Region of Yogyakarta show with mosaic and severe chlorotic symptoms due to Begomovirus infection. Total DNA samples were subject to PCR amplification using universal primer for begomovirus PALIV1978/PAR1C715 and specific primer for betasatellite β01/β02. The PCR amplification produced a DNA band measuring ± 1600bp, identical size of begomovirus. The amplification of the betasatellite specific primer produced a DNA band featuring ± 1300bp, identical size of betasatellites that were associated with begomovirus in the sample. The results of DNA sequencing, suggested that begomovirus in this study had a close relationship with TYLCKaV from Thailand and Indonesia. Characterization of the satellite-based on nucleotide sequence revealed the presence of stem-loop structures, satellite conservative regions, and adenine-rich regions that resembled structures present in the betasatellite, which were associated with Tomato leaf curl virus and Ageratum yellow vein virus, with no ORF found. These results indicated that the TYLCKaV could be associated with a non-coding satellite. This result is the first report regarding the TYLCKaV association with a non-coding satellite in Indonesia.

Control of the Bemisia tabaci/Tomato yellow leaf curl virus complex on protected tomato crops in Algarve (Portugal)*

EPPO Bulletin ◽  
2002 ◽  
Vol 32 (1) ◽  
pp. 31-35
Author(s):  
A. F. Arsenio ◽  
E. Neto ◽  
N. Ramos ◽  
S. Mangerico ◽  
E. Fortunato ◽  
...  
Keyword(s):  
Bemisia Tabaci ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Virus Complex ◽  
Leaf Curl Virus ◽  
Leaf Curl

Study of a collection of tomato hybrids with genetic resistance to the yellow leaf curl virus in Southern Russia

2020 ◽  
pp. 30-34
Author(s):  
С.Ф. Гавриш ◽  
Т.А. Редичкина ◽  
А.В. Буц ◽  
Г.М. Артемьева
Keyword(s):  
Resistance Genes ◽  
Molecular Genetic Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Mosaic Virus ◽  
Average Weight ◽  
Yellow Leaf ◽  
The South ◽  
Economically Valuable Traits ◽  
Leaf Curl Virus ◽  
Leaf Curl

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.

Sign in / Sign up

Export Citation Format

Share Document