Plant-parasitic nematodes in field crops in South Africa. 6. Soybean

Nematology ◽  
2001 ◽  
Vol 3 (5) ◽  
pp. 447-454 ◽  
Author(s):  
Alexander McDonald ◽  
Hendrika Fourie ◽  
Gideon Loots
Keyword(s):  
South Africa ◽  
Nematode Species ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Production Areas ◽  
First Time ◽  
Pratylenchus Zeae ◽  
Plant Parasitic ◽  
Meloidogyne Species

AbstractTwelve plant-parasitic nematode genera and 25 species were identified in soil and root samples collected from 17 localities in the soybean production areas of South Africa during the 1995/96 season. Predominant endoparasites found included Meloidogyne incognita, M. javanica, M. hapla, M. ethiopica, Pratylenchus zeae and P. brachyurus. Meloidogyne species occurred in 91% of all root samples, P. zeae in 87% and P. brachyurus in 33%. The occurrence of the three predominant endoparasites was not restricted to sandy soil, but they were also prevalent in soils with high clay contents. Other endoparasitic nematode species were Pratylenchus crenatus, P. teres, P. neglectus, P. thornei, Rotylenchulus parvus and Ditylenchus africanus. Nematodes found in soil included Helicotylenchus dihystera and Scutellonema brachyurus, which occurred in 78 and 71%, respectively, of all soil samples. Other nematodes found in soil samples were Helicotylenchus pseudorobustus, H. digonicus, H. microcephalus, Scutellonema truncatum, Rotylenchus unisexus, Mesocriconema sphaerocephalum, Paratrichodorus minor, Longidorus pisi, Xiphinema vanderlindei, X. elongatum and Tylenchorhynchus goffarti. Highest prominence values (PV) for Meloidogyne species were recorded on cultivars Prima, Bakgat, Tamboti, Hutcheson and Knap and the lowest on cultivars PAN812, SCS1, Nyala, Gazelle and A7119. Eight nematode genera and 19 species extracted during this study are reported for the first time in association with soybean in South Africa.

scholarly journals Five Species of Plant Parasitic Nematodes (Order: Tylenchidae) Affecting Vegetable Crops of Nepal

2016 ◽  
Vol 10 (1) ◽  
pp. 10-14
Author(s):  
Arvind K. Keshari ◽  
Ranjana Gupta
Keyword(s):  
Life Sciences ◽  
Nematode Species ◽  
Parasitic Nematodes ◽  
Kathmandu Valley ◽  
Vegetable Crops ◽  
Plant Parasitic Nematodes ◽  
Morphometric Data ◽  
First Time ◽  
Plant Parasitic

During a survey for plant parasitic nematodes affecting various vegetable crops grown in three hilly districts surrounding Kathmandu Valley, Nepal, five species of order Tylenchidae are reported for the first time from Nepal.The nematode species are Hoplolaimus indicus, Tylenchorhynchus mashhoodi, Helicotylenchus incisus, Microposthonia paraxestis and Hemicriconemoides cocophilus.All the species are illustrated with line diagrams and described with their morphometric data along with localities and host plants.International Journal of Life Sciences 10 (1) : 2016; 10-16

scholarly journals Plant-Parasitic Nematodes Are Potential Pathogens of Miscanthus × giganteus and Panicum virgatum Used for Biofuels

Plant Disease ◽  
2011 ◽  
Vol 95 (4) ◽  
pp. 413-418 ◽  
Author(s):  
Tesfamariam Mekete ◽  
Kimberly Reynolds ◽  
Horacio D. Lopez-Nicora ◽  
Michael E. Gray ◽  
Terry L. Niblack
Keyword(s):  
Panicum Virgatum ◽  
Damage Threshold ◽  
Threshold Value ◽  
Nematode Species ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Population Densities ◽  
Miscanthus Giganteus ◽  
Plant Parasitic

A survey of Miscanthus × giganteus and switchgrass plots throughout the midwestern and southeastern United States was conducted to determine the occurrence and distribution of plant-parasitic nematodes associated with these biofuel crops. During 2008, rhizosphere soil samples were collected from 24 Miscanthus × giganteus and 38 switchgrass plots in South Dakota, Iowa, and Illinois. Additional samples were collected from 11 Miscanthus × giganteus and 10 switchgrass plots in Illinois, Kentucky, Georgia, and Tennessee the following year. The 11 dominant genera recovered from the samples were Pratylenchus, Helicotylenchus, Xiphinema, Longidorus, Heterodera, Hoplolaimus, Tylenchorhynchus, Criconemella, Paratrichodorus, Hemicriconemoides, and Paratylenchus. Populations of Helicotylenchus, Xiphinema, and Pratylenchus were common and recorded in 90.5, 83.8, and 91.9% of the soil samples from Miscanthus × giganteus, respectively, and in 91.6, 75, and 83.3% of the soil samples from switchgrass, respectively. Prominence value (PV) (PV = population density × √frequency of occurrence/10) was calculated for the nematodes identified. Helicotylenchus had the highest PV (PV = 384) and was followed by Xiphinema (PV = 152) and Pratylenchus (PV = 72). Several of the nematode species associated with the two biofuels crops were plant parasites. Of these, Pratylenchus penetrans, P. scribneri, P. crenatus, Helicotylenchus pseudorobustus, Hoplolaimus galeatus, X. americanum, and X. rivesi are potentially the most damaging pests to Miscanthus × giganteus and switchgrass. Due to a lack of information, the damaging population thresholds of plant-parasitic nematodes to Miscanthus × giganteus and switchgrass are currently unknown. However, damage threshold value ranges have been reported for other monocotyledon hosts. If these damage threshold value ranges are any indication of the population densities required to impact Miscanthus × giganteus and switchgrass, then every state surveyed has potential for yield losses due to plant-parasitic nematodes. Specifically, Helicotylenchus, Xiphinema, Pratylenchus, Hoplolaimus, Tylenchorhynchus, Criconemella, and Longidorus spp. were all found to have population densities within or above the threshold value ranges reported for other monocotyledon hosts.

scholarly journals Plant-parasitic nematodes associated with cultivated and wild olive trees in Crete, Greece

2020 ◽  
Vol 13 (1) ◽  
pp. 24-28 ◽  
Author(s):  
A. Archidona-Yuste ◽  
C. Cantalapiedra-Navarrete ◽  
J.E. Palomares-Rius ◽  
P. Castillo ◽  
E.A. Tzortzakakis
Keyword(s):  
Nematode Species ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Wild Olive ◽  
Olive Trees ◽  
First Time ◽  
Plant Parasitic

SummaryThe present study is part of a survey for the identification of plant-parasitic nematodes in the rhizosphere of cultivated and wild olive trees in Crete, Greece. Sixteen species corresponding to 13 genera are added to 20 species belonging to 8 genera, previously reported in the survey. Seven nematode species, Filenchus ditissimus, Filenchus vulgaris, Ogma civellae, Pratylenchoides crenicauda, Psilenchus hilarulus, Tylenchus elegans, and Zygotylenchus guevarai, are recorded for the first time in Greece.

Plant-parasitic nematodes associated with weeds in subsistence agriculture in South Africa

Nematology ◽  
2012 ◽  
Vol 14 (7) ◽  
pp. 875-887 ◽  
Author(s):  
Keikantsemang N. Ntidi ◽  
Hendrika Fourie ◽  
Alexander H. Mc Donald ◽  
Dirk De Waele ◽  
Charlotte M.S. Mienie
Keyword(s):  
South Africa ◽  
Parasitic Nematode ◽  
Cynodon Dactylon ◽  
Nematode Species ◽  
Plant Parasitic Nematode ◽  
Cyperus Rotundus ◽  
Parasitic Nematodes ◽  
Frequency Of Occurrence ◽  
Plant Parasitic Nematodes ◽  
Plant Parasitic

Twenty-nine plant-parasitic nematode species belonging to 15 genera, as well as two fungus-feeding nematode genera and one species, were identified from soil and root samples of weeds collected from 67 localities situated in subsistence production regions of South Africa during a survey from 2005-2006. Of these, 16 nematode species from four genera were reported for the first time to infect or to be associated with weeds. The predominant endo- and semi-endoparasites identified both from soil and root samples were Meloidogyne species, Pratylenchus zeae, Helicotylenchus dihystera and Rotylenchus unisexus. Based on PCR technology, three Meloidogyne species, M. hapla, M. incognita and M. javanica, have been identified in roots of weeds sampled. Thirty weed species representing 26 genera were identified as hosts of Meloidogyne species, while 38 belonging to 35 genera were associated with various other plant-parasitic nematodes. Meloidogyne species were predominant in the roots of Chloris virgata, Cynodon dactylon and Amaranthus hybridus. The frequency of occurrence of Meloidogyne species, H. dihystera and R. unisexus was significantly and positively correlated with localities in terms of % clay and % silt. The same trend was evident for these three taxa in terms of rainfall, while the opposite was observed in terms of their frequency of occurrence and pH. Principal component analysis results substantiated the latter. It also suggested that all four predominant plant-parasitic nematode species tend to occur more frequently at localities where maize was mono-cropped as well as where maize and vegetables were planted in rotation. Cynodon dactylon, Cyperus rotundus, Datura stramonium, Tagetes minuta and Eleusine corocana had the highest frequency of occurrence of weeds sampled. Identification of weeds that maintain plant-parasitic nematodes, particularly Meloidogyne species, suggested that these pathogens can have a negative impact on crop production when not controlled timely and effectively.

scholarly journals Diversity of plant parasitic nematodes associated with rhizosphere of maize from different areas of district Rajouri, Jammu and Kashmir, India

2020 ◽  
Vol 4 (1) ◽  
Author(s):  
Kaisar Ahmad Allie ◽  
Ali Asghar Shah ◽  
Shaheen Majeed Wani ◽  
Kaisar Ahmad Bhat ◽  
Nazia Kouser ◽  
...  
Keyword(s):  
Parasitic Nematode ◽  
Nematode Species ◽  
The Other ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Absolute Frequency ◽  
Jammu And Kashmir ◽  
Maize Plants ◽  
Pratylenchus Zeae ◽  
Plant Parasitic

Diversity of plant parasitic nematodes in the rhizosphere of maize (Zea mays) from some areas of District Rajouri, Jammu and Kashmir was studied. A total of ten plant parasitic nematode species were found to be associated with the rhizosphere of maize plants in these areas. The nematode species were Pratylenchus zeae, P. brachyurus, Helicotylenchus dihystera, Longidorus brevicaudatus, L. elongatus, Xiphinema diversicadatum, X. elongatum, Tylenchorhynchus spp. Ditylenchus spp. and Criconemoides spp. The most dominant and frequently occurring species was found to be P. zeae, with absolute frequency of 86.66% followed by P. brachyurus (80%), H. dihystera, (76.66%) and L. brevicaudatus (73.33). Contrarily, the least frequent was Criconemoides spp. (36.66%) followed by Tylenchorhynchus spp. and Ditylenchus spp. with absolute frequencies of 53.33% and 60%. Similar trend was observed in case of relative frequencies. In case of P. zeae, mean density of 56 and relative density of 16.05% was observed followed by P. brachyurus and H. dihystera with mean densities and relative densities of 50.33, 14.43% and 49, 14.04% respectively. On the other hand, Criconemoides spp. and Tylenchorhynchus spp. showed mean densities of 6.33 and 23.33 and absolute densities of 1.81% and 6.68% respectively. P. zeae exhibited high prominence value of 57.85 followed by P. brachyurus (49.96). The least prominence value was found in Criconemoides spp. (4.05) followed by Tylenchorhynchus spp. with prominence value of 18.30.

scholarly journals Characterisation of plant-parasitic nematodes Helicotylenchus digonicus and H. vulgaris from the rhizosphere of grapevines in Crimea, Russia

2021 ◽  
Vol 39 ◽  
pp. 02003
Author(s):  
Svetlana Lychagina ◽  
Yakov Volkov ◽  
Marina Volkova ◽  
Tatyana Kolganova ◽  
Sergei Tabolin
Keyword(s):  
Nematode Species ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
28S Rrna ◽  
Plant Parasitic Nematodes ◽  
Stylet Length ◽  
Plant Parasitic

During 2016-2020, about 120 soil samples were collected from the rhizosphere of grapes in different vineyards of the Central and Southern regions of Crimea. Two morphologically close nematode species, Helicotylenchus digonicus and Helicotylenchus vulgaris, were found at all sampling sites in the Yalta, Sevastopol, Simferopol and Bakhchisarai districts. Morphologically, these species could be differentiated by the stylet length and the shape of tails. In addition, these species have significant differences in sequences of the D2-D3 expansion segments of the 28S rRNA.

scholarly journals First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 291-291 ◽  
Author(s):  
W. Ye ◽  
Y. Zeng ◽  
J. Kerns
Keyword(s):  
North Carolina ◽  
South Carolina ◽  
Sequence Data ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Body Width ◽  
Cervical Papilla ◽  
Stubby Root Nematode ◽  
Plant Parasitic

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

scholarly journals Surveying for Virus-vectoring Nematodes in Container-grown Blueberry Plants in Oregon

2016 ◽  
Vol 17 (3) ◽  
pp. 175-176 ◽  
Author(s):  
D. Sharma-Poudyal ◽  
C. Fraley ◽  
N. K. Osterbauer
Keyword(s):  
Soil Surface ◽  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Plastic Sheet ◽  
Gravel Bed ◽  
Effective Barrier ◽  
Gravel Layer ◽  
Potting Media ◽  
Plant Parasitic

The goal of this study was to determine the risk of finding virus-vectoring nematodes in containerized blueberry plants placed on gravel. To detect dagger nematode, soil, and potting media samples were collected from blueberry nurseries growing plants in containers using soilless potting media, with the containers placed on a gravel bed or, for one nursery, on a plastic sheet placed on the soil surface. Potting media samples were collected from containers holding plants and soil samples were collected from beneath the gravel or plastic barrier. Nematodes were extracted from all of the samples using sucrose centrifugation. No dagger or other plant parasitic nematodes were detected in any of the samples tested. These results suggest no treatment of soilless potting media is necessary before planting blueberries into containers. Similarly, the gravel layer seems to be an effective barrier for suppressing dagger and other plant parasitic nematodes. Accepted for publication 25 July 2016. Published 8 August 2016.

The distribution of Tylenchulus semipenetrans and other parasitic nematodes associated with citrus in northern Victoria

1978 ◽  
Vol 18 (90) ◽  
pp. 148 ◽  
Author(s):  
RH Brown
Keyword(s):  
Soil Samples ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Tylenchulus Semipenetrans ◽  
Citrus Orchards ◽  
Citrus Nematode ◽  
Plant Parasitic

Citrus orchards in the Cobram district of northern Victoria were surveyed in 1976 for the presence of plant parasitic nematodes; in particular for the citrus nematode Tylenchulus semipenetrans. One hundred and forty-six soil samples were collected from 38 orchards. Nine genera were recorded, the most prevalant being Tylenchulus and Paratrichodorus (95 per cent and 37 per cent respectively, of all samples). T. semipenetrans was present in all orchards sampled. Population levels of T. semipenetrans larvae exceeded 1000 per 500 g of soil in 60 per cent of samples.

Sign in / Sign up

Export Citation Format

Share Document