Assessment of Multidrug Resistance and FLT3 Internal Tandem Duplication in Patients with Plasmacytoid Dendritic Cell Leukemia.

Abstract Plasmacytoid dendritic cell leukemia (pDCL) is a rare hematological malignancy, characterized by the expression of CD123hi, CD4+, CD56+ and absence of myeloid or lymphoid markers. Patients usually have an aggressive clinical course, short survival and increased rates of relapse after chemotherapy. We report the clinical, biological, phenotypic features of three cases of pDCL and their multidrug resistance profile (MDR) and FLT3 internal tandem duplication (FLT3-ITD) status. Methods and Results: we reanalyzed 193 patients with acute leukemia, studied at the laboratory of Cellular Biology and Flow Cytometry at diagnosis, between 2002 and 2006. Among them three patients presented imunnophenotypic features of dendritic cell malignancy. At diagnosis, patients (2M/1F, aged 63, 64 and 74 y) presented anemia, thrombocytopenia and the WBC count was 6.7, 12.6 and 45.1×109/L, with circulating blast cells in two cases (69% and 80%). Bone marrow blasts showed L2/M0 (one case) or monocytoid morphology (2 cases). Lymph nodes enlargement and splenomegaly in one case and cutaneous lesions in one other case were observed. Multiparametric flow cytometry using a large panel of monoclonal antibodies showed the presence of CD123hi, CD4, HLA-DR and CD45dim in all cases, CD56 in two and the absence of any lineage-associated markers expression (CD13-, CD117-, CD15-, CD14-, CD64-, MPO-, CD41-, CD3-, CD19-, CD16-). Karyotype was available in one patient and it was normal. MDR was studied on leukemic cells by Rhodamine 123 efflux test in the presence/absence of Verapamil, using flow cytometry. All three cases showed increased rates of functional drug efflux. The FLT3-ITD was assessed by polymerase chain reaction in mononuclear cells DNA using the following primers: 14F (GCAATTTAGGTATGAAAGCAGC) and 15R (CTTTCAGCATTTTGACGGCAACC) and it was negative in all patients. Two patients were submitted to chemotherapy (BFM-ALL-5/93 protocol in one and Idarubicin + Cytarabine in another). One patient was resistant to IDA+ Cytarabine and the other died 20 days after BFM protocol induction by infection. The untreated patient died one month later. Discussion To our knowledge, these are the first cases of dendritic cell malignancies where the MDR functional expression and FLT3-ITD status were evaluated. Additionally, they are the first Brazilian cases of pDCL reported. None of the patients presented the FLT3-ITD; moreover a recent study (Dijkman R et al, Blood, 2007) of gene expression profile using microarray demonstrated that FLT3 mRNA was upregulated on pDCL. Our results suggest that the expression of MDR might contribute to the adverse outcome in this rare entity and to the poor response to chemotherapy described by others. Literature data suggest intensive treatment with bone marrow transplantation for pDCL but the addition of MDR-modulators to the chemotherapy schedules might be useful for the management of this disorder, especially in elderly patients.

Download Full-text

Expression of FLT3 Internal Tandem Duplication in Pediatric Patients with Acute Myeloid Leukemia and Its Correlation with Multidrug Resistance.

Blood ◽

10.1182/blood.v114.22.4427.4427 ◽

2009 ◽

Vol 114 (22) ◽

pp. 4427-4427

Author(s):

Zhenhua Qiao ◽

Jiangning Zhao ◽

Lianrong Xu ◽

Quanyi Lu ◽

Xiaoqing Niu ◽

...

Keyword(s):

Bone Marrow ◽

Acute Myeloid Leukemia ◽

Multidrug Resistance ◽

Myeloid Leukemia ◽

Tandem Duplication ◽

Pediatric Patients ◽

Remission Rate ◽

Internal Tandem Duplication ◽

Flt3 Internal Tandem Duplication ◽

Acute Myeloid

Abstract Abstract 4427 FLT3 Internal Tandem Duplication is a kinase mutation frequently observed in cases of adult acute myeloid leukemia (AML). This study was aimed to investigate the expression of FLT3 internal tandem duplication (FLT3-ITD) in pediatric patients with acute myeloid leukemia (AML) and to analyse the clinical features of patients with mutations and the relation of FLT3-ITD with multidrug resistance gene 1 (mdr1). Samples were analysised from eighty-one new diagnosed pediatric patients with AML. The diagnosis was based on French-American-British (FAB) criteria. Immunophenotyping was done by flow cytometry. For each patient, several clinical and biological characteristics were analyzed (age, WHO performance status, WBC count at diagnosis, bone marrow blasts, FAB subtypes, immunologic phenotype, and cytogenetics). The expressions of FIT3-ITD and mdr1 gene in bone marrow samples was determined by RT-PCR. patients were treated with uniform chemotherapy. Statistical analysis were carried by SAS. The results indicated that the FLT3-ITDs were detected in 8 out of 81 pediatric patients (9.88%) and all mutations detected were hybrid, while less frequently this mutation was detected in adult patients. Although they were irrelevant with sex and immunophenotypes, the mutations seemed predominant in older pediatric patients. The average age is 14-year-old in the patients with mutations, but 9-year-old in those without mutation (P=0.039). The leukocyte counts and bone marrow blast cell counts in pediatric patients with FLT3-ITD at diagnosis were higher than those in pediatric patients without FLT3-ITD (median of 58.4×10∧9/L versus 19.49 ×10∧9/L, p = 0.001 and median of 78.5% versus 54.4%,p = 0.041 respectively). The normal chromosomes were found in most pediatric patients with FLT3-ITD, although no significane in the stastistics. The patients with FLT3-ITD had lower induction remission rate (only 25%), but the patients without FLT3-ITD had higher remission rate (76.1%). According results detected by RT-PCR, the mdr1 gene was found in 27 pediatric patients, but only 3 out of 8 pediatric patients with FLT3-ITD were detected to express both FLT3-ITD and mdr1. It is concluded that the FLT3-ITD is a frequent mutation in pediatric patients with AML, especially in the elder pediatric patients. It is related with higher leukocyte counts and bone marrow blast cell counts, which may due to the continual activation of Flt3 tyrosine kinase. The prognosis of these patients with mutations is worse and the induction remission rate is lowe. But the FLT3-ITD not relates with the mdr1, which suggests that the low induction rate is not resulted from the multidrug resistance, at least not from the P-glycoprotein (Pgp) activity. So the common MDR modulators may be uneffective for therapy of the patients with FLT3-ITD. Disclosures: No relevant conflicts of interest to declare.

Download Full-text

A Case of Plasmacytoid Dendritic Cell Leukemia

Acta Medica Marisiensis ◽

10.2478/amma-2013-0027 ◽

2013 ◽

Vol 59 (2) ◽

pp. 111-114

Author(s):

Judit Beáta Köpeczi ◽

I Benedek ◽

Erzsébet Benedek ◽

Enikő Kakucs ◽

Aliz Tunyogi ◽

...

Keyword(s):

Bone Marrow ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Initial Response ◽

Skin Lesions ◽

High Rate ◽

Response To Treatment ◽

Cell Leukemia ◽

Cutaneous Lesions ◽

Hla Dr

AbstractIntroduction: Plasmacytoid dendritic cell leukemia is a rare subtype of acute leukemia, which has recently been established as a distinct pathologic entity that typically follows a highly aggressive clinical course in adults. The aim of this report is to present a case of plasmacytoid dendritic cell leukemia due to its rarity and difficulty to recognize and diagnose it.Case report: We present a case of a 67 year-old man who presented multiple subcutaneous lesions on his face, neck, chest and upper extremities with reddish-brown, brown colour. In the bone marrow aspirate 83% of the blast cells were found. Immunophenotypically the blasts were positive for CD4, CD56, CD123 (high intensity), CD36, CD22, CD10 (10.42%), CD33, HLA-DR, CD7 (9.24%), CD38 (34.8%) and negative for CD13, CD64, CD14, CD16, CD15, CD11b, CD11c, CD3, CD5, CD2, CD8, CD19, CD20, CD34. The skin biopsy showed lymphohistiocytoid infiltration in the dermis. The patient was diagnosed with acute plasmacytoid dendritic cell leukemia and received polychemotherapy with rapid response of skin lesions and blastic infiltration of the bone marrow. After 3 courses of polychemotherapy the cutaneous lesions reappeared and multiplied. The blast infiltration in the bone marrow increased to 70%. A more aggressive polychemotherapy regimen was administered, but the patient presented serious complications (febrile neutropenia) and died in septic shock 8 months after the initiation of treatment.Conclusions: Immunophenotyping of blasts cells is indispensable in the diagnosis of plasmacytoid dendritic cell leukemia. The CD4+, CD56+, lin-, CD123 ++high, CD11c-, CD36+, HLA-DR+, CD34-, CD45+ low profile is highly suggestive for pDCL. The outcome of plasmacytoid dendritic cell leukemia is poor. Despite the high rate of initial response to treatment, early relapses occur and the patients die of disease progression.

Download Full-text

The diagnostics of blastic plasmocytoid dendritic cell neoplasm: report of five cases

Pediatric Hematology/Oncology and Immunopathology ◽

10.24287/1726-1708-2021-20-3-60-67 ◽

2021 ◽

Vol 20 (3) ◽

pp. 60-67

Author(s):

I. A. Demina ◽

S. A. Kashpor ◽

O. I. Illarionova ◽

M. E. Dubrovina ◽

A. A. Dudorova ◽

...

Keyword(s):

Bone Marrow ◽

Flow Cytometry ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Skin Lesions ◽

Flow Cytometry Data ◽

Hematological Disorders ◽

Pediatric Hematology ◽

National Medical ◽

Cell Neoplasm

The diagnosis of rare hematological disorders requires a comprehensive clinical and laboratory investigation with careful interpretation of all test results. Blastic plasmacytoid dendritic cell neoplasm (BPDCN) is one of such rare entities. We have performed a retrospective analysis of the results of immunophenotyping, cytomorphology and cytogenetics of bone marrow tumor cells from 5 patients with BPDCN aged from 8 to 51 years. The study was approved by the Independent Ethics Committee of the Dmitry Rogachev National Medical Research Center of Pediatric Hematology, Oncology and Immunology. No specific characteristics of blasts were found. No correlation with the treatment and outcomes was noted as well: 3 patients died of progression or relapse (2 and 1, respectively). Bone marrow immunophenotyping is probably the most valuable laboratory test which allows physicians to establish the proper diagnosis in the absence of skin lesions. Flow cytometry immunophenotyping is the only technique used to determine the antigen profile that enables us to distinguish normal plasmacytoid dendritic cells from tumor ones by the presence (or absence) of the expression of CD2, CD7, CD38, CD56, CD303 etc. In the present paper, we provide a detailed description of five cases of BPDCN and main methods for flow cytometry data analysis. The parents of the patients agreed to use the information, including photos of children, in scientific research and publications.

Download Full-text

Intracytoplasmic detection of TCL1-but not ILT7-by flow cytometry is useful for blastic plasmacytoid dendritic cell leukemia diagnosis

Cytometry Part A ◽

10.1002/cyto.a.22072 ◽

2012 ◽

Vol 81A (8) ◽

pp. 718-724 ◽

Cited By ~ 11

Author(s):

Fanny Angelot-Delettre ◽

Sabeha Biichle ◽

Christophe Ferrand ◽

Estelle Seilles ◽

Béatrice Gaugler ◽

...

Keyword(s):

Flow Cytometry ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Cell Leukemia ◽

Leukemia Diagnosis

Download Full-text

Diagnosis of Blastic Plasmacytoid Dendritic Cell Neoplasm By Using 10-Colour Flow Cytometry and Achievement of Remission By Hypercvad Therapy

Blood ◽

10.1182/blood.v124.21.2365.2365 ◽

2014 ◽

Vol 124 (21) ◽

pp. 2365-2365 ◽

Cited By ~ 1

Author(s):

Uday Deotare ◽

Elizabeth Hyjek ◽

Anna Porwit ◽

Rumina Musani ◽

David Barth ◽

...

Keyword(s):

Bone Marrow ◽

Flow Cytometry ◽

Overall Survival ◽

Dendritic Cell ◽

Research Funding ◽

Plasmacytoid Dendritic Cell ◽

Leukemic Cells ◽

Front Line ◽

Hla Dr ◽

Cell Neoplasm

Abstract Background: Although classified by WHO 2008 as belonging to the category “Acute myeloid leukemia and related precursor neoplasms”, Blastic Plasmacytoid Dendritic Cell Neoplasm (BPDCN) presents as an acute leukemia (AL) only in a minority of cases. There are only few studies describing the comprehensive immunophenotypic pattern of BPDCN in the bone marrow. Furthermore, given the rarity of this hematologic malignancy optimal frontline therapy is unclear. Patients and Methods: This retrospective analysis evaluates the diagnostic flow cytometry pattern and outcome of 9 patients who were diagnosed with BPDCN at the Princess Margaret Cancer Centre between December 2008 and June 2014. A four tube 10-color flow cytometry (FCM) panel has been used to correctly make the diagnosis of BPDCN in 6 patients, whereas a 5-colour panel was used in the remaining patients in conjunction with immunohistochemistry. The following markers were included in the10-color panel: Tube 1: CD65 FITC, CD13 PE, CD14 ECD, CD33 PC5.5, CD34 PC7, CD117 APC, CD7 A700, CD11b A750, CD16 PB, and CD45 KO; Tube 2: CD36 FITC, CD64 PE, CD56 ECD, CD33 PC5.5, CD34 PC7, CD123 APC, CD19 A700, CD38 A750, HLA-DR PB, and CD45 KO; Tube 3: CD71 FITC, CD11c PE, CD4 ECD, CD33 PC5.5, CD34 PC7, CD2 APC, CD10 A700, CD235a A750, CD15 PB, and CD45 KO; Tube 4:nuclear (n) TdT FITC, cytoplasmic (cyt.) MPO PE, CD14 ECD, CD33 PC5.5, CD34 PC7, cyt.CD79a APC, cyt.CD22 A700, CD19 A750, cyt.CD3 PB, and CD45 KO. Results: Median age was 66 years (range, 25 to 91 years); 3 patients were over the age of 70 years. Fifty-six percent were males. All presented with skin lesions and 78% presented each with lymphadenopathy and bone marrow involvement. Cytogenetics were poor-risk in 2 patients, intermediate-risk in 3 and unknown or inconclusive in 4. By 10-color FCM, leukemic cells were in the blast gate (CD45dim/low SSC) and were positive for CD4(bright), CD33(dim), CD56(heterogenous), CD123(bright), CD36, CD38, HLA-DR, CD71, but negative for CD10, CD11b, CD13, CD14, CD15, CD16, CD19, CD34, CD64, CD65, CD235a. Other markers, such as cyt.MPO, cyt.CD3, cyt.CD22 and nTdT were negative, while dim cyt.CD79a was seen in 3 cases. CD7 expression was found in 5 cases, whereas CD2 and CD117 were found in single cases only. BM involvement by BPDCN leukemic cells ranged from 27% to 92% of the marrow cellularity. Skin involvement showed dense infiltrate of cells with blastoid morphology and characteristic grenz zone. Seven patients received front-line induction therapy with HyperCVAD with an overall response rate of 86% (4 complete remissions (CR), 2 unconfirmed CRs). One patient died of multi-organ failure during induction. Three of 6 responders underwent planned allogeneic hematopoietic cell transplantation (HCT); 1 patient has since died of acute graft versus host disease (GVHD), whereas 2 are alive in remission with chronic GVHD, 12 and 14 months post transplant with complete donor chimerism. One transplant ineligible patient relapsed 22 months after achievement of CR1. Median follow-up of all patients was 12 months with a overall survival at 1 year of 59.3% for the entire group. Patients who underwent allogeneic HCT had overall survival at 1 year of 66.7% and for the chemotherapy group was 27.8% at 1 year.(p=0.34). Conclusion: An accurate diagnosis of BPDCN can be made by 10-colour FCM using a 4-tube acute leukemia panel. BPDCN demonstrates a characteristic pattern of antigen expression . Although front-line induction chemotherapy with HyperCVAD can yield high CR rates, allogeneic HCT should be performed in first CR for transplant eligible patients, as this appears to be required for long term durable remissions. For transplant ineligible or relapsed BPDCN patients, there is an unmet need for novel therapeutic agents. Disclosures Porwit: Beckman-Coulter: Speakers Bureau. Gupta:Novartis: Consultancy, Honoraria, Research Funding; Incyte Corporation: Consultancy, Research Funding.

Download Full-text

Flow cytometry to identify bone-marrow relapse in blastic plasmacytoid dendritic cell neoplasm: a case report

Revista Brasileira de Hematologia e Hemoterapia ◽

10.1016/j.bjhh.2017.04.005 ◽

2017 ◽

Vol 39 (3) ◽

pp. 274-277

Author(s):

Mariela Granero Farias ◽

Fabiane Spagnol Pedrazzani ◽

Luis Carlos Zanandrea Contin ◽

Ana Paula Alegretti ◽

Lisandra Della Costa Rigoni ◽

...

Keyword(s):

Bone Marrow ◽

Flow Cytometry ◽

Case Report ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Cell Neoplasm

Download Full-text

Relapse of tagraxofusp treated blastic plasmacytoid dendritic cell neoplasm with loss of CD123 expression

Journal of Hematopathology ◽

10.1007/s12308-021-00479-z ◽

2021 ◽

Author(s):

Rohit Gulati ◽

Asma Abu-Salah ◽

Tareq Salous ◽

Mehdi Nassiri

Keyword(s):

Bone Marrow ◽

Flow Cytometry ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Primary Treatment ◽

Resistance Mechanisms ◽

Elderly Male ◽

Bone Marrow Specimen ◽

Cell Neoplasm ◽

Targeted Immunotherapy

AbstractTagraxofusp, a CD123-based-targeted immunotherapy, was recently approved to treat blastic plasmacytoid dendritic cell neoplasm (BPDCN) with excellent response. Also, a subset of BPDCN shows resistance to tagraxofusp. These resistant cases continue to express CD123, which forms the basis of the continued utility of tagraxofusp in newer combination chemotherapies to overcome resistance in BPDCN. Herein, we report a case of an elderly male with BPDCN that achieved complete remission on initial primary treatment with tagraxofusp. However, BPDCN relapsed after 1.5 years while on treatment, with loss of CD123 expression. At relapse, the neoplasm was comprehensively immunophenotyped by flow cytometry (performed on both peripheral blood and bone marrow specimen) and by immunohistochemical evaluation of the bone marrow clot section. The neoplasm at relapse was diagnostic of BPDCN with a lack of CD123 expression. This case highlights a potential limitation of current and upcoming tagraxofusp-based multidrug therapies, at least in a subset of refractory BPDCN. We believe our report will serve as a sentinel to incite future investigations involving alternate resistance mechanisms in BDPCN.

Download Full-text

Blastic plasmacytoid dendritic cell neoplasm

Anais Brasileiros de Dermatologia ◽

10.1590/abd1806-4841.20132388 ◽

2013 ◽

Vol 88 (6 suppl 1) ◽

pp. 158-161 ◽

Cited By ~ 8

Author(s):

André Lencastre ◽

Joana Cabete ◽

Alexandre João ◽

Pedro Farinha ◽

Gilda Ferreira ◽

...

Keyword(s):

Bone Marrow ◽

Flow Cytometry ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Flow Cytometry Analysis ◽

Bone Marrow Biopsies ◽

Cervical Mass ◽

Cell Neoplasm ◽

History Of ◽

Thoracic And Abdominal

Blastic plasmacytoid dendritic cell neoplasm is a rare and aggressive hematodermic neoplasia with frequent cutaneous involvement and leukemic dissemination. We report the case of a 76-year-old man with a 2 month history of violaceous nodules and a tumor with stony consistency, located on the head, and mandibular, cervical and supraclavicular lymphadenopathies. Multiple thoracic and abdominal adenopathies were identified on computerized tomography. Flow cytometry analysis of the skin, lymph node and bone marrow biopsies demonstrated the presence of plasmocytoid dendritic cell neoplastic precursor cells (CD4+, CD45+, CD56+ and CD123+ phenotype). After initial clinical and laboratorial complete remission with chemotherapy, the patient died due to relapse of the disease associated with the appearance of a cervical mass with medullary compromise.

Download Full-text

Demethylating Agents As a Salvage Treatment in Relapsed Myeloid Diseases Following Allogeneic Bone Marrow Transplantation

Blood ◽

10.1182/blood.v120.21.4216.4216 ◽

2012 ◽

Vol 120 (21) ◽

pp. 4216-4216

Author(s):

Sangeeta Atwal ◽

Anjum Bashir Khan ◽

Victor Noriega ◽

Yogesh Jethava ◽

Michelle Kenyon ◽

...

Keyword(s):

Bone Marrow ◽

Dendritic Cell ◽

Plasmacytoid Dendritic Cell ◽

Allogeneic Bone Marrow ◽

Allogeneic Bone ◽

Cell Leukemia ◽

Demethylating Agents ◽

Cytogenetic Remission ◽

Pre Treatment ◽

Number Of Cycles

Abstract Abstract 4216 Patients who relapse after allogeneic bone marrow transplant (BMT) for acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS) have a poor prognosis. Salvage treatments rely on further chemotherapy, donor lymphocyte infusions (DLI) and experimental therapies. However, the treatments are often toxic and the prognosis grim particularly in patients over the age of 60 years. More recently, DNMT3A inhibition such as 5-Azacytidine (5-Aza) and Decitabine have been shown not only to have an antileukemic activity, but are also capable of inducing an antileukemic cytotoxic T lymphocyte response as well as reversal in the ratio of Tregs to Th17 CD4 cellular reactions. We therefore evaluated the role of these agents in 17 patients who have relapsed post-transplant. The indications for transplant were AML (n=13), of whom 9 had transformed from either MDS (n=5), aplastic anaemia (n=1), MDS/MPD (n=1), myelofibrosis (n=1) or CML (n=1); Of the remainder: Refractory anaemia with excess blasts II (n=2); plasmacytoid dendritic cell leukemia (n=1); MPD/MDS with trisomy 21 (n=1). 13 were treated with 5-Aza; 6 Decitabine and 2 had both 5-Aza and Decitabine as separate courses. In total, there were 20 courses of treatment, each comprising of a variable number of cycles of 5-Aza or Decitabine. 5-Aza was administered at a standard dosage of 75mg/m2 for 7 days every 28 days and Decitabine 20mg/m2 for 5 days every 28 days. There was no toxicity from the treatment such that patients required a dose reduction. charcteristics mean (RANGE) Age (yrs) 52 (35–67) Days from transplant before starting demethylating agent for overt relapse 559 (38–1956) Blast % before starting 5-Aza or Decitabine 25.7 (1–91) Number of cycles of 5-Azacytidine per course completed (n=14) 4 (1–15) Number of cycles of Decitabine (n=6) 2.5 (2–3) Duration of response from stopping 5-Aza or Decitabine treatment before relapse 186 (177–195) Pre-treatment blast % in responders (n=11) 22 (1–89) Pre-treatment blast % in non-responders (n=9) 31 (4–91) Responses were categorized as stable disease (SD), partial response (PR), morphological (MR) or complete cytogenetic remission (CCR) and were seen in 11 of 20 courses of treatment (55%) of which SD = 2, PR = 2, MR = 7, CCR = 0. Specifically 2 patients had SD whilst they remained on 5-Azacytidine. Of the 2 with PR, 1 had a drop in blast percentage but did not enter into remission. The other with plasmacytoid dendritic cell leukemia relapsed with recurrence of biopsy proven skin lesions had a transient response on 5-Azacytidine but progressed during the 5th cycle. 7 achieved a MR (<5% bone marrow blasts), none went into cytogenetic remission. Amongst the group of responders, 5 out of 9 patients (55%) had AML, 4 out of the 5 achieved MR and 1 PR. The mean duration of morphological remission was 186 days. Of the remainder 9 courses of treatment that did not respond, all had a pre-transplant diagnsosis of AML, of which 6 had pre-existing MDS and I myelofibrosis. There was no difference in response according to the pre-treatment blast percentage in the marrow. Conversely, one patient achieved a morphological remission after 3 cycles of Decitabine with a pre-treatment blast percentage of 89%. Equally there was no difference in response according to cytogenetic risk at first presentation or pre-treatment relapse between responders and non-responders. Importantly, 30% of patients treated with DNMT3A inhibitors are alive. In the majority of patients, donor chimersm remained unchanged pre and post 5-Aza and Dec. 2 patients received DLI immediately post 5-Azacyditine as consolidation. Out of the 17 patients, 5 had graft-versus-host-disease (GVHD) temporally associated with commencing 5-Aza or Decitabine. 2 in this group had GVHD (grade 1–3) and 3 chronic GVHD (grade 1–3). These results suggest that demethylating agents are effective following allogeneic BMT. It is encouraging that of the patients who responded, over half had a pre-transplant diagnosis of AML however more numbers are required to support this. The effect of these agents are thought to be both antileukemic for example by increasing expression of tumour associated antigens, and immunomodulatory by delaying the effect on the methylation pattern of genes that result in a significant decrease in Tregs. Disclosures: Mufti: Celgene Corporation: Consultancy, Research Funding, Speakers Bureau.

Download Full-text