Infection of breeding horses with equine arteritis virus (EAV) can result in abortion in up to 50% of mares (Del Piero F 2000 Vet. Pathol. 37, 287–296). Viral transmission occurs in body fluids, including semen (Golnik W et al. 1986 Zentralblatt für Veterinarmedizin 33, 413–417), with infected males potentially shedding virus indefinitely. Previously, the only means of preventing EAV transmission via semen was to remove identified shedders from the breeding pool. Recent medical studies have shown that viral infectivity can be removed from the semen of HIV or hepatitis C patients by a sequential method of sperm preparation: i.e. centrifugation on a discontinuous density gradient, followed by swim-up, (e.g. Bujan et al. 2002 Fertil. Steril. 78, 1321–1323; Levy et al. 2002 Hum. Rep. 17, 2650–2653). Human sperm prepared by this method have been used in over 1000 assisted reproduction attempts without sero-conversion of mothers or children (Lyerly A et al. 2001 Fertil. Steril. 75, 843–858). The current study investigates whether a sequential preparation technique of centrifugation on an EquiPure density gradient followed by a swim-up into a sperm maintenance medium can remove EAV from stallion ejaculates. Aliquots (1mL) of stallion semen, extended in Kenny’s medium, were spiked with known quantities of EAV at three levels corresponding to 1.0, 10 and 100 TCID50/mL−1. The latter was considered to be representative of levels seen in natural infection (Timoney PJ et al. 1987 J. Reprod. Fertil. (Suppl. 35), 95–102). Aliquots of spiked semen were prepared by centrifugation on EquiPure gradients. After centrifuging the resulting sperm pellets in EquiSperm Wash, the sperm were subjected to a swim-up treatment (all sperm preparation material from NidaCon, Gothenburg, Sweden). Aliquots of the sperm preparations, the unspiked extended semen, and spiked extended semen were stored at −70°C for viral assay by nested PCR (Belak S et al. 1994 Proc. 7th Int. Conf. Equine Inf. Dis. pp 33–38). The sensitivity of this assay is less than 1 PFU mL−1 of virus in seminal plasma, as validated by Belak et al. Using the PCR technique, a region from the nucleocapsid gene of EAV is amplified, resulting in a 170-base-pair product. Details of the primer sequences used are as follows: first TCGATGGCGTCAAGACGATCAC and GGTTCCTGGGTGGCTAATAACTACTTCAAC; second CGCAACCCACTCAGGCTATTATTG and GGTAGGAACCCAACTGACGGTG. The untreated spiked samples were all positive for EAV, whereas the sperm preparations from the spiked semen, after density gradient and swim-up, were negative for EAV. A negative control (water) and the unspiked extended ejaculate were also negative. These preliminary results indicate that the sequential technique of centrifugation on an EquiPure density gradient followed by a swim-up is potentially a useful and simple tool for the removal of EAV from the semen of shedding stallions. Further experiments will investigate whether the virus can be removed from naturally infected ejaculates. We are grateful to Prof. Twink Allen and Miss Clare Tiplady of the Equine Fertility Unit, Newmarket, UK, for providing samples of stallion semen. This study is partially funded by Eureka (E-2967).
Sperm Dynein AAA1 and AAA2 Expression in Human Sperm : A Regulation in Sperm Preparation