scholarly journals MicroRNA-126 (MiR-126): A Crucial Player in the Retina

2020 ◽  
Vol 3 (1) ◽  
pp. 198-200
Author(s):  
Sonali Nashine
Keyword(s):  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Chromosome 9 ◽  
Human Endothelial Cells ◽  
Non Coding Rna ◽  
Human Genomes ◽  
Epidermal Growth

The MiR-126 is a highly conserved, non-coding RNA that is primarily expressed in human endothelial cells and is a crucial regulator of angiogenesis and vasculogenesis [1]. In human genomes, MiR-126 is found within intron 7 of the Epidermal Growth Factor-Like domain 7 (EGFL7) gene on chromosome 9 [2,3]. Processing of pre-MiR-126 i.e., the precursor miRNA, generates two mature strands: a) MiR-126-3p with the sequence: UCGUACCGUGAGUAAUAAUGCG and b) MiR-126-5p with the sequence: CAUUAUUACUUUUGGUACGCG [4,5].

scholarly journals Influence of hepatocyte growth factor, epidermal growth factor, and mycophenolic acid on endothelin‐1 synthesis in human endothelial cells

2001 ◽  
Vol 16 (12) ◽  
pp. 2310-2316 ◽  
Author(s):  
Cornelia Haug ◽  
Alexandra Schmid‐Kotsas ◽  
Theresia Linder ◽  
Max G. Bachem ◽  
Adolf Gruenert ◽  
...  
Keyword(s):  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Hepatocyte Growth Factor ◽  
Mycophenolic Acid ◽  
Human Endothelial Cells ◽  
Endothelin 1 ◽  
Epidermal Growth ◽  
Hepatocyte Growth

Effect of vascular endothelial growth factor and epidermal growth factor on iatrogenic apoptosis in human endothelial cells

2004 ◽  
Vol 67 (2) ◽  
pp. 277-284 ◽  
Author(s):  
Maria Cristina Vinci ◽  
Barbara Visentin ◽  
Federico Cusinato ◽  
Giovanni Battista Nardelli ◽  
Lucia Trevisi ◽  
...  
Keyword(s):  
Vascular Endothelial Growth Factor ◽  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Vascular Endothelial ◽  
Human Endothelial Cells ◽  
Epidermal Growth ◽  
Endothelial Growth Factor

Epidermal growth factor induces intracellular Ca2 oscillations in microvascular endothelial cells

2003 ◽  
Vol 194 (2) ◽  
pp. 139-150 ◽  
Author(s):  
Francesco Moccia ◽  
Roberto Berra-Romani ◽  
Simona Tritto ◽  
Silvia Signorelli ◽  
Vanni Taglietti ◽  
...  
Keyword(s):  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Microvascular Endothelial Cells ◽  
Epidermal Growth ◽  
Microvascular Endothelial

Retinoid-Induced Potentiation of Epidermal Growth Factor Mitogenic Effect on Corneal Endothelial Cells

Cornea ◽  
1990 ◽  
Vol 9 (1) ◽  
pp. 41???44 ◽  
Author(s):  
Didier Junqu??ro ◽  
Guy Modat ◽  
Claude Coquelet ◽  
Claude Bonne
Keyword(s):  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Corneal Endothelial Cells ◽  
Mitogenic Effect ◽  
Epidermal Growth
Sign in / Sign up

Export Citation Format

Share Document