The Effect of Brimonidine 0.15% on the Development of Bulbar Redness Following Femtosecond Laser Assisted Cataract Surgery

Purpose: To assess the effect of brimonidine tartrate 0.15% on reducing subconjunctival hemorrhage, measured with a bulbar redness score, following femtosecond laser assisted cataract surgery (FLACS). Patients and Methods: A prospective, masked randomized controlled study was done using single-blinded simple randomization. All FLACS cases completed between June and August 2019 were included except those on anticoagulation or with prior conjunctival surgery. All operated eyes received usual preoperative eye drops, while Study group received added brimonidine. Exclusion criteria included >1 vacuum attempt during FLACS and any intraoperative complications. All subjects received Bulbar Redness (BR) Score and Analyzed Area (AA) imaging by Oculus 5M Keratograph preoperatively and postoperatively. AA including non-conjunctival structures, <25mm2, or postoperative AA values >10% different from preoperative values were excluded from final analysis. Absolute values and differences between mean postoperative and preoperative BR and AA were compared using Student’s t-test. Results: 62 eyes (Study group=25, Control group=37) of 56 patients were randomized and included for analysis. Baseline demographic comparison between the two groups were similar. Preoperative BR score in the Study group trended higher (1.62) than Control (1.40, p=0.07), while postoperative BR score remained similar between groups (p=0.70). Difference in postoperative and preoperative BR score was significantly larger in the study group (-0.21±0.56) than controls (+0.06±0.43, p=0.036). Conclusions: The use of preoperative brimonidine in FLACS reduces the amount of postoperative subconjunctival hemorrhage following FLACS, as observed by reduced bulbar redness. Oculus 5M BR scoring has potential to be used as an objective method of quantifying subconjunctival hemorrhage after ophthalmic surgeries and procedures.

Navigating Challenges after Xen

The XEN Gel Stent is a surgical implant for the treatment of glaucoma unresponsive to maximum tolerated medical therapy, with higher predictability and fewer sight-threatening complications than trabeculectomy or tube shunts. While complications following XEN implantation may be less common than in other glaucoma procedures, they are not completely avoidable. This paper elaborates the most commonly reported complications following XEN implantation with an aim to mitigate their occurrence by understanding the pathophysiology behind them. In addition, the authors provide insights from the literature and their own experience and make recommendations for management when complications do occur.

Evaluation of Retinal Blood Flow in Glaucoma Patients Pre and Post Treatment using OCT angiography

Purpose: To evaluate retinal blood flow changes in glaucoma after intraocular pressure (IOP) lowering and to determine whether a correlation exists with retinal capillaries blood flow with IOP changes using optical coherence tomography angiography (OCTA) Materials and Methods: OCTA images were collected from 24 glaucomatous eyes for the macula and 21 eyes for the optic disc in a prospective, cross-sectional observational study. Microvascular changes were analysed at two retinal layers: deep vascular plexus (DVP) and the superficial vascular plexus (SVP) as well as choriocapillaries (CC), were compared pre and six weeks post intraocular pressure (IOP) lowering treatment. Results: Retinal blood flow across the macula showed no statistical significance at: SVP (z-score = -0.887), DVP (z-score = -1.093) and CC (z-score = -1.423). Further, no statistically significant difference in retinal blood flow was observed across the disc: SVP (z-score = -0.918), DVP (z-score = -1.057) and CC (z-score = -0.295). While the IOP showed improvement (z-score = -5.049), visual acuity deteriorated (z-score= 1.686) Conclusion: No statistical difference was found in the data for all layers of both the areas surrounding the disc and macula at 6 weeks. OCTA can detect microstructural defects and future longitudinal studies may provide further insight into effects of IOP lowering treatment on retinal blood flow in glaucoma patients in longer term.

MicroRNA-126 (MiR-126): A Crucial Player in the Retina

The MiR-126 is a highly conserved, non-coding RNA that is primarily expressed in human endothelial cells and is a crucial regulator of angiogenesis and vasculogenesis [1]. In human genomes, MiR-126 is found within intron 7 of the Epidermal Growth Factor-Like domain 7 (EGFL7) gene on chromosome 9 [2,3]. Processing of pre-MiR-126 i.e., the precursor miRNA, generates two mature strands: a) MiR-126-3p with the sequence: UCGUACCGUGAGUAAUAAUGCG and b) MiR-126-5p with the sequence: CAUUAUUACUUUUGGUACGCG [4,5].

Acute vision loss in a patient with chronic esophageal stenosis

Purpose: To describe a unique cause of Valsalva Retinopathy (VR) with an alternative surgical approach to chronic non-clearing pre-foveal hemorrhage. Method: Case presentation. Results: A 45-year-old African American female presented with acute vision loss from 20/20 to count fingers (CF) in her right eye. Ophthalmoscopy and ocular coherence tomography (OCT) showed old yellow-red pre-retinal opacityscuring the fovea. After 1 month of conservative management with no improvement, Pars Plana Vitrectomy (PPV) with posterior hyaloid membrane removal without ILM peeling was performed with the patient’s best-corrected visual acuity (BCVA) dramatically improved to 20/25. Discussion: We raise the question regarding the role of ILM peeling in treating premacular hemorrhage. Even without ILM peeling, our patient’s hemorrhage resolved after the procedure. This suggests that PPV combined with posterior hyaloid removal is a safer and effective alternative to surgical treatment in patients with certain clinical conditions. In addition, we provide clear evidence to support the location of the hemorrhage in VR as both sub-hyaloid and sub-ILM.

Astigmatic Outcomes after Wavefront-Guided and Wavefront-Optimized Refractive Surgeries for Myopia with Low to Moderate Cylinder

Purpose: To compare the efficacy and accuracy of wavefront-guided (WFG) and wavefront-optimized (WFO) PRK and LASIK for the treatment of myopia with low to moderate astigmatism.Methods: In this prospective cohort study, 215 active duty military service members (430 eyes, mean spherical equivalent -3.61 ± 1.53 D) electing either PRK or LASIK were randomized to undergo WFG or WFO treatment. Up to 12 months, postoperative visual outcomes following surgeries were compared between 4 treatment groups: WFG PRK, WFG LASIK, WFO PRK, and WFO LASIK for myopia with 0.25 to 0.50 D astigmatism (≤ 0.50 D cyl subgroup) and ≥ 0.75 D astigmatism (≥ 0.75 D cyl subgroup). High and low contrast visual acuities were assessed and vector analysis was performed.Results: At 12 months postoperatively, the surgically induced astigmatism, magnitude of error, correction and flattening indices were significantly different between treatment groups (P values ≤ 0.001) in the ≤ 0.50 D cyl subgroup. In ≥ the 0.75 D cyl subgroup, there were no significant differences in vector analysis parameters except for the magnitude of error and correction index (P values ≤ 0.010). The treatment groups were comparable in terms of postoperative uncorrected distance visual acuity, manifest spherical equivalent, and best-corrected low contrast visual acuity.Conclusions: No treatment modality showed consistent superiority in correcting low to moderate astigmatism. Overall, both PRK and LASIK using either wavefront-guided or wavefront-optimized laser platforms were similarly effective and accurate in treating myopia with a low to moderate amount of astigmatism.

Impact of Acute Emotional Stress on the Tear Quality of Students from a Medical School in Campina Grande: Paraiba Brazil

Background: Stress acts on the nervous system impairing lachrymal gland function. Thus, one can hypothesize that medical students under academic evaluation, with acute emotional stress, could suffer changes in tear quality, which was the purpose of this study.Methods: The prospective, longitudinal, observational and analytic study was performed at Faculty of Medical Sciences-Campina Grande, Paraíba, Brazil. It was randomly recruited, 80 (5.8%) students, 42 (52.5%) women and 38 (47.5%) men, with ages ranging from 18 to 42 year-old (22.9 ± 4.9 years), median of 21.5 years. Exclusion criteria include all students who presented with any disease or condition that could affect the tear quality. The BUT was assessed before and after 35 days of academic examination. The continuous parameters were expressed by their mean ± standard deviation. Wilcoxon test was used for assessing difference between means. P ≤ 0.05 was used for rejecting the null hypothesis. The research was approved by the Institutional Ethics Committee.Results: Stress was present in all students immediately of taking academic evaluation; ranging as follows: mild-15 (18.7%); moderate-41 (51.3%), and severe 24 (30.0%) (How was this stress assessed to arrive at mild, moderate and severe). The mean BUT in the right eye was significantly higher after the 35-day interval (before 8.5 ± 3.1 seconds versus 9.6 ± 3.0 seconds - p = 0.0016). Similarly, the mean BUT in the left eye was significantly higher after the 35-day interval (before 8.5 ± 3.1 seconds versus 9.4 ± 2.9 seconds - p = 0.0053.Conclusion: There was a decrease in the BUT immediately before academic evaluation. However, there was nocorrelation or association with the stressful parameters caused during this period with the BUT measurements,including emotional stress levels, night sleep time before academic examination. It was observed a tendency to return to BUT baseline parameters, later 45 days after knowledge of student performance in the academic examinations.

Associations of hypertension Diabetes Smoking History and SNPs with Responses to Aflibercept Treatment for tAMD and PCV

Purpose: To determine the correlation between therapeutic effects of IVA treatment on typical AMD (tAMD), and polypoidal choroidal vasculopathy (PCV) and the history of hypertension, diabetes mellitus, smoking history and single nucleotide polymorphisms (SNPs).Methods: Prospective, interventional study. Subjects were assigned to 125 untreated patients with exudative AMD (tAMD: 58 patients, PCV: 67 patients, male: 91:34, mean age 73.4 years). Among the tAMD patients, there were 28 bimonthly injections 30 who received pro re nata (PRN) injections after three monthly injections. Among the PCV patients, 33 were treated with bimonthly injections and 34 received PRN injections after three monthly injections. Therapeutic effects were evaluated by best-corrected visual acuity (BCVA), central retinal thickness (CRT), subfoveal choroidal thickness (CCT), and exudative change after 3 months and 1 year from initial treatment, and also the history of hypertension, diabetes mellitus, smoking and five SNPs (rs10490924, rs800292, rs699947, rs1061170, rs13278062).Results: Improvements of BCVA, CRT were observed in all groups at 1 year after initial treatment. The one-yearchange in CRT showed significant improvement in nonsmokers than smokers in tAMD. The one-year change in CRT indicated a significant improvement in non-diabetic patients in PCV. There was more exudation at both 3 months and 1 year who had smoking history in tAMD. With respect to the rs1061170 mutation of tAMD, in the case with TT type, significant residual exudation was noted at both 3 and 12 months.Conclusions: The history of smoking and diabetes could be influence to IVA treatment for AMD.

Adjunctive Antifibrotic Therapy with Mitomycin C and 5-Fluorouracil: A Review of their use in Glaucoma Surgery and Considerations around Ophthalmic Compounding

Background: Antifibrotics and antimetabolites, including 5-fluorouracil (5-FU) and mitomycin C (MMC), have been used for decades to improve ophthalmic surgical outcomes, most notably with glaucoma filtering procedures. Adjuvant MMC and 5-FU also enhance the efficacy of minimally invasive subconjunctival drainage implants now being used. The authors feel that a review of the usage and safety of these agents is merited, especially in light of updated and new USP guidelines for compounded and hazardous drugs.Main Body: The mode of perioperative administration of MMC during glaucoma surgery is evolving with a shift from the traditional sponge application to subconjunctival injection, allowing for a more precise dosing and controlled administration of this medication. Several studies demonstrate effective use of MMC and 5-FU, at a variety of different doses. Most of these studies use compounded MMC and 5-FU. Glaucoma surgeons must be careful in how they source MMC, however, as the U.S. Food & Drug Administration (FDA) expects physicians to use FDA-approved drug products when clinically appropriate. When a physician determines a compounded version of MMC is clinically necessary for an individual patient, the FDA closely regulates how and when drug products can be compounded and by what type of facilities. There will also be additional increased scrutiny on storage and disposal of MMC and 5-FU as new regulations are introduced.Conclusion: This review of MMC and 5-FU and their role in glaucoma surgery will address questions regarding drug safety, procurement, use, and disposal.

Plasmapheresis in Ophthalmology

Loss of sight is one of the most severe disabling factors in human. The total number of such people is known to account for millions worldwide. In North America alone more than 1 million are completely blind and about 14 million have some degree of sight loss. There are many different diseases that lead to sight loss such as diabetic retinopathy, senile macular degeneration, various types of autoimmune retinopathy, optic nerves damage and many others. As a rule, they cannot be corrected with glasses, and not always amenable to drug therapy. Often the cause of these diseases is accumulation of various autoantibodies and other metabolites, the molecules large size of which does not allow them to be excreted by the kidneys and the fact of their accumulation indicates impossibility of their removal with help of drug therapy. It makes us resort to such method of their direct removal from the body as plasmapheresis and the aim of this study is to justify its use in ophthalmology.