scholarly journals Influence of hepatocyte growth factor, epidermal growth factor, and mycophenolic acid on endothelin‐1 synthesis in human endothelial cells

2001 ◽  
Vol 16 (12) ◽  
pp. 2310-2316 ◽  
Author(s):  
Cornelia Haug ◽  
Alexandra Schmid‐Kotsas ◽  
Theresia Linder ◽  
Max G. Bachem ◽  
Adolf Gruenert ◽  
...  
Keyword(s):  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Hepatocyte Growth Factor ◽  
Mycophenolic Acid ◽  
Human Endothelial Cells ◽  
Endothelin 1 ◽  
Epidermal Growth ◽  
Hepatocyte Growth

Inhibitory Effect of Epidermal Growth Factor and Hepatocyte Growth Factor on Endothelin-1 Release by Rabbit Proximal Tubule Cells

2000 ◽  
Vol 36 ◽  
pp. S248-S251 ◽  
Author(s):  
Cornelia Haug ◽  
Theresia M. Linder ◽  
Alexandra Schmid-Kotsas ◽  
Simone Hetzel ◽  
Friedlinde Ernst ◽  
...  
Keyword(s):  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Hepatocyte Growth Factor ◽  
Proximal Tubule ◽  
Inhibitory Effect ◽  
Proximal Tubule Cells ◽  
Endothelin 1 ◽  
Epidermal Growth ◽  
Tubule Cells ◽  
Hepatocyte Growth

Inhibitory Effect of Epidermal Growth Factor and Hepatocyte Growth Factor on Endothelin-1 Release by Rabbit Proximal Tubule Cells

2000 ◽  
Vol 36 (Supplement 1) ◽  
pp. S248-S251 ◽  
Author(s):  
Cornelia Haug ◽  
Theresia M. Linder ◽  
Alexandra Schmid-Kotsas ◽  
Simone Hetzel ◽  
Friedlinde Ernst ◽  
...  
Keyword(s):  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Hepatocyte Growth Factor ◽  
Proximal Tubule ◽  
Inhibitory Effect ◽  
Proximal Tubule Cells ◽  
Endothelin 1 ◽  
Epidermal Growth ◽  
Tubule Cells ◽  
Hepatocyte Growth

scholarly journals Inhibition of DNA synthesis by somatostatin in rat hepatocytes stimulated by hepatocyte growth factor or epidermal growth factor

1992 ◽  
Vol 163 (1) ◽  
pp. 169-173 ◽  
Author(s):  
Norihiro Kokudo ◽  
]Piyush C. Kothary ◽  
Frederic E. Eckhauser ◽  
Toshikazu Nakamura ◽  
Steven E. Raper
Keyword(s):  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Hepatocyte Growth Factor ◽  
Dna Synthesis ◽  
Rat Hepatocytes ◽  
Epidermal Growth ◽  
Inhibition Of Dna Synthesis ◽  
Hepatocyte Growth

scholarly journals Hepatocyte Growth Factor Induces Resistance to Anti-Epidermal Growth Factor Receptor Antibody in Lung Cancer

2012 ◽  
Vol 7 (2) ◽  
pp. 272-280 ◽  
Author(s):  
Tadaaki Yamada ◽  
Shinji Takeuchi ◽  
Kenji Kita ◽  
Hideaki Bando ◽  
Takahiro Nakamura ◽  
...  
Keyword(s):  
Lung Cancer ◽  
Epidermal Growth Factor Receptor ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Hepatocyte Growth Factor ◽  
Growth Factor Receptor ◽  
Receptor Antibody ◽  
Epidermal Growth ◽  
Hepatocyte Growth

scholarly journals MicroRNA-126 (MiR-126): A Crucial Player in the Retina

2020 ◽  
Vol 3 (1) ◽  
pp. 198-200
Author(s):  
Sonali Nashine
Keyword(s):  
Endothelial Cells ◽  
Growth Factor ◽  
Epidermal Growth Factor ◽  
Chromosome 9 ◽  
Human Endothelial Cells ◽  
Non Coding Rna ◽  
Human Genomes ◽  
Epidermal Growth

The MiR-126 is a highly conserved, non-coding RNA that is primarily expressed in human endothelial cells and is a crucial regulator of angiogenesis and vasculogenesis [1]. In human genomes, MiR-126 is found within intron 7 of the Epidermal Growth Factor-Like domain 7 (EGFL7) gene on chromosome 9 [2,3]. Processing of pre-MiR-126 i.e., the precursor miRNA, generates two mature strands: a) MiR-126-3p with the sequence: UCGUACCGUGAGUAAUAAUGCG and b) MiR-126-5p with the sequence: CAUUAUUACUUUUGGUACGCG [4,5].

Sign in / Sign up

Export Citation Format

Share Document