scholarly journals Occurrence and Distribution of Viruses Associated with Okra and Their Alternative Hosts in Kaduna and Zamfara States, Nigeria.

2021 ◽  
Vol 8 (03) ◽  
pp. 177-186
Author(s):  
Gilima ZaharaddeenSamaila ◽  
David Kashina Boniface ◽  
Olalekan Oyeleke Banwo ◽  
Alegbejo Mathew Dada ◽  
Charles Chindo Agart ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Disease Incidence ◽  
Enzyme Linked Immunosorbent Assay ◽  
Chain Reaction ◽  
Elisa Kit ◽  
Cropping Season ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Das Elisa ◽  
Leaf Curl

One of the major constraints to production of okra (Abelmoschus esculentus L.) in Nigeria and in particular in Kaduna and Zamfara States, is the problem of okra mosaic virus and okra leaf curl virus. This study was carried out to provide information on the occurrence and distribution of okra mosaic and okra leaf curl viruses on okra, in Kaduna and Zamfara states, Nigeria. A survey of okra-producing farms was carried out during dry and wet seasons of 2017 cropping season in Kaduna (Zaria, Lere, and Igabi Local Government Areas) and Zamfara (Gusau, Bungudu, and Zurmi LGAs) states. Leaf samples (15) of symptomatic okra plants were collected from each farm in the study area. The total number of plants and the number of symptomatic plants within each subplot were recorded, and the disease incidence was determined. Double Antibody Sandwich Enzyme-Linked Immunosorbent Assay (DAS- ELISA) kit was used in the detection of Okra Mosaic Virus while Polymerase Chain Reaction (PCR) was employed for the detection Okra Leaf Curl Virus. The results showed that all the okra leaf samples tested for OLCV were negative in this study while OkMV was tested positve in all the samples with a recorded incidence of  20 % and 14 %  in Kaduna and Zamfara states respectively, however, only 8 out of total weed samples were also tested positive for OKV, but all were tested negative to OLCV.

scholarly journals Strawberry latent ringspot virus Infecting Roses in India

Plant Disease ◽  
2004 ◽  
Vol 88 (1) ◽  
pp. 86-86 ◽  
Author(s):  
S. Kulshrestha ◽  
V. Hallan ◽  
G. Raikhy ◽  
R. Ram ◽  
A. A. Zaidi
Keyword(s):  
Plant Viruses ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Chain Reaction ◽  
Specific Primers ◽  
Chenopodium Amaranticolor ◽  
Elisa Kit ◽  
Local Lesions ◽  
Young Leaves ◽  
Polymerase Chain

Rose is an economically important crop of India and the world. A survey of rose plantations in and near the Kangra Valley of Himachal Pradesh, India, showed virus-like symptoms, including yellow flecking in young leaves and reduction in leaflet size, while some were symptomless. These symptoms are similar to those for Strawberry latent ringspot virus (SLRSV) (1). Sap inoculation from symptomatic and some symptomless leaves to Chenopodium amaranticolor resulted in chlorotic local lesions followed by systemic chlorosis. SLRSV was detected in this indicator host and six rose cultivars (Happiness, Iceberg, First Prize, Ganga, Pink Panther, and Oklahoma) showing characteristic symptoms of SLRSV using enzyme-linked immunosorbent assay (ELISA) with ELISA kit (DSMZ, Braunschweig, Germany). Reverse transcription-polymerase chain reaction was performed with SLRSV-specific primers (2), and a product of the expected size of ˜181 bp was amplified. The authenticity of the fragment was confirmed by sequencing. Isolated SLRSV was also inoculated to seed-grown rose seedlings and after 20 days postinoculation the same symptoms (yellow flecking in young leaves) were observed. These results established the identity of the virus that caused yellow flecking on rose leaves in India as SLRSV. To our knowledge, this is the first report of SLRSV infecting rose in India. References: (1) A. F. Murant. Strawberry latent ringspot virus. No. 126 in: Description of Plant Viruses, CMI/AAB, Surrey, U.K., 1974. (2) E. Bertolini et al. J. Virol. Methods 96:33, 2001.

scholarly journals Development of Bottle Gourd Lines Resistant to Zucchini Yellow Mosaic Virus Using Ethyl Methanesulfonate Mutagenesis

HortScience ◽  
2021 ◽  
pp. 1-7
Author(s):  
Asma Mohammed Saeed Al-Kubati ◽  
Baoshan Kang ◽  
Liming Liu ◽  
Aqleem Abbas ◽  
Qinsheng Gu
Keyword(s):  
Mosaic Virus ◽  
Zucchini Yellow Mosaic Virus ◽  
Ethyl Methanesulfonate ◽  
Bottle Gourd ◽  
Yellow Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Practical Strategy ◽  
Resistant Lines ◽  
Polymerase Chain ◽  
Das Elisa

Zucchini yellow mosaic virus (ZYMV) causes serious damage to cucurbit crops worldwide and can be spread by aphids, by mechanical injury, and in seeds. With the popularization of cucurbit grafting, the use of susceptible rootstock has increased the risk of ZYMV infection in cucurbit crops. In China, the bottle gourd (Lagenaria siceraria) is a widely used rootstock in grafted watermelon production. However, few resistant bottle gourds are available commercially. This study developed bottle gourd lines resistant to ZYMV using ethyl methanesulfonate (EMS) mutagenesis. A new mutated bottle gourd population (M1) was generated by treating seeds with EMS. Diverse phenotypes were observed in the seedlings, flowers, and fruit of M2 plants, some of which are of potential commercial interest, such as dwarfing and different fruit shapes. Based on the M2 phenotypes, 106 M3 lines were selected and screened for resistance to ZYMV by mechanical inoculation and agroinfiltration. Nine M3 lines were resistant to ZYMV during three tests. One inbred M4 line (177-8) was developed and showed stable resistance and no virus when tested using a double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and polymerase chain reaction. These resistant lines are promising materials for developing watermelon rootstock and exploring resistance genes as new ZYMV-resistant resources. EMS induction could be a practical strategy for creating resistant cucurbit crops.

scholarly journals Serological Studies Using Polyclonal Antisera Prepared Against the Viral Coat Protein of Four Begomoviruses Expressed in Escherichia coli

Plant Disease ◽  
2002 ◽  
Vol 86 (10) ◽  
pp. 1109-1114 ◽  
Author(s):  
A. M. Abouzid ◽  
J. Freitas-Astua ◽  
D. E. Purcifull ◽  
J. E. Polston ◽  
K. A. Beckham ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Coat Protein ◽  
Mosaic Virus ◽  
Yellow Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Thin Sections ◽  
Golden Yellow ◽  
Polyclonal Antisera ◽  
Leaf Curl Virus ◽  
Leaf Curl

Polyclonal rabbit antisera were produced to the coat protein of Bean golden mosaic virus Brazil isolate (BGMV), Cabbage leaf curl virus (CabLCV), Tomato yellow leaf curl virus (TYLCV), and Tomato mottle virus (ToMoV), all expressed in Escherichia coli by the pETh expression vector. The expressed coat protein of each virus was purified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis for use as an immunogen. The antisera to BGMV, CabLCV, TYLCV, and ToMoV reacted in indirect (plate-trapping) enzyme-linked immunosorbent assay (ELISA) with extracts from begomovirus-infected tissue. The antisera to BGMV, CabLCV, TYLCV, and ToMoV also reacted specifically with the test begomovirus antigens in leaf imprint blots and Western blots. The CabLCV and TYLCV antisera were used to detect Bean golden yellow mosaic virus antigens by immunogold labeling of thin sections of infected bean tissues. In tissue blot immunoassays, the TYLCV antiserum reacted well with TYLCV antigens but not with ToMoV antigens, while CabLCV antiserum reacted well with ToMoV antigens and weakly with TYLCV antigens. The results indicate that polyclonal antisera prepared to expressed begomovirus coat proteins were useful for the detection of begomoviruses in an array of assays.

scholarly journals First Report of Tobacco as a Natural Host of Tomato yellow leaf curl virus in Spain

Plant Disease ◽  
2005 ◽  
Vol 89 (8) ◽  
pp. 910-910 ◽  
Author(s):  
M. I. Font ◽  
C. Córdoba ◽  
A. García ◽  
R. Santiago ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Simultaneous Detection ◽  
Tomato Yellow Leaf ◽  
Natural Host ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yellow Leaf ◽  
Tobacco Plants ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Two begomovirus species, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), have been identified as causal agents of tomato yellow leaf curl disease (TYLCD) in Spain. TYLCSV was reported in Spain in 1992 and TYLCV in 1997 on tomato crops (3). TYLCV was also reported in common bean (Phaseolus vulgaris L.) and pepper (Capsicum annuum L.) crops in southern Spain in 1997 and 1999, respectively. During the summer of 2004, symptoms of yellowing, crumpling, and necrosis of new leaves were observed sporadically in young, field-grown tobacco (Nicotiana tabacum L.) plants in the Badajoz Province. These tobacco plants were next to tomato crops where TYLCV was detected for the first time in Badajoz in 2003. In September 2004, four symptomatic tobacco plants were selected for double antibody sandwich enzyme linked immunosorbent assay (DAS-ELISA) and polymerase chain reaction (PCR) identification analyses. Serological analyses were carried out in two repetitions and with the following polyclonal antisera: Potato virus Y (PVY) (Loewe Biochemica, Sauerlach, Germany); Tobacco mild green mosaic virus (produced in our laboratory); Tobacco mosaic virus (BIO-RAD, Marnes-La-Coquette, France); and Tomato spotted wilt virus (Loewe Biochemica). A simplified method of duplex PCR was used for a rapid, sensitive, and simultaneous detection of TYLCSV and TYLCV (2). Mixed infections of PVY and TYLCV were detected in all four tobacco samples tested. TYLCV infection was confirmed using the primer pair TY-1/TY-2 specific for the coat protein (CP) gene of begomoviruses (1). The CP fragment was digested with the restriction enzyme AvaII, and the pattern obtained corresponded to that obtained from TYLCV-infected tomato that served as a positive control. Two PCR products from different tobacco samples were sequenced and both showed 100% identity with the corresponding region (Almería) of TYLCV (GenBank Accession No. AJ489258) and 99% with TYLCV-Mild (Spain) (GenBank Accession No. AJ519441), confirming the diagnosis. The symptoms observed in the tobacco plants can not be attributed solely to TYLCV since the virus was present in a mixed infection with PVY. However, tobacco infected with TYLCV may serve as an important alternate host for TYLCV in the tomato cropping system. To our knowledge, this is the first report of N. tabacum as a natural host of TYLCV in Spain. References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) P. Martínez-Culebras et al. Ann. Appl. Biol. 139:251, 2001. (3) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
M. Quiñones ◽  
D. Fonseca ◽  
Y. Martinez ◽  
G. P. Accotto
Keyword(s):  
Field Survey ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Tomato Production ◽  
First Report ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

scholarly journals Snake melon asteroid mosaic virus, a Tentative New Member of the Genus Sobemovirus Infecting Cucurbits

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 153-157 ◽  
Author(s):  
Hervé Lecoq ◽  
Gasim Dafalla ◽  
Brigitte Delécolle ◽  
Catherine Wipf-Scheibel ◽  
Cécile Desbiez
Keyword(s):  
Mosaic Virus ◽  
Aphis Gossypii ◽  
Polyclonal Antiserum ◽  
Enzyme Linked Immunosorbent Assay ◽  
Virus Particles ◽  
Polymerase Chain ◽  
Polymerase Chain Reaction Primers ◽  
Melon Aphid ◽  
Das Elisa ◽  
Eastern Sudan

A virus isolate (Su-95-67) was obtained from a snake melon (Cucumis melo var. flexuosus) plant presenting severe chlorotic spots, mosaic, stunting, and leaf deformations collected in Eastern Sudan in 1995. Su-95-67 was easily mechanically transmissible and had a host range limited to a few cucurbit species. Isometric virus particles approximately 30 nm in diameter were observed in leaf dip preparations. A cytopathological study did not reveal alterations specific for a virus genus or family. A polyclonal antiserum was obtained and used in double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Su-95-67 was transmitted by seed at a low rate, by the red melon beetle (Aulacophora foveicollis), but not by the melon aphid (Aphis gossypii). Because Su-95-67 shared several properties with sobemoviruses, generic Sobemovirus reverse-transcription polymerase chain reaction primers were developed. They allowed amplification of a 384-bp fragment from extracts of plants infected by two sobemoviruses or by Su-95-67 but not from healthy plants extracts. Sequence comparison confirmed that Su-95-67 belongs to a new tentative Sobemovirus species for which we propose the name Snake melon asteroid mosaic virus (SMAMV). DAS-ELISA tests conducted on extracts of virus-infected cucurbit plants collected from 1992 to 2003 revealed the presence of SMAMV in 10.2% of 600 samples originating from different regions of Sudan.

scholarly journals Squash Yellow Leaf Curl Virus: A New Whitefly-Transmitted Poty-Like Virus

Plant Disease ◽  
1998 ◽  
Vol 82 (5) ◽  
pp. 475-478 ◽  
Author(s):  
A. A. Zouba ◽  
M. V. Lopez ◽  
H. Anger
Keyword(s):  
Mosaic Virus ◽  
Zucchini Yellow Mosaic Virus ◽  
Yellow Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Watermelon Mosaic Virus ◽  
Yellow Leaf ◽  
Serological Tests ◽  
Thin Sections ◽  
Leaf Curl Virus ◽  
Leaf Curl

A severe yellow and leaf curl disease affecting field squash was found in the Batinah region of the Sultanate of Oman. The symptoms appear as small yellow spots, diffuse veinal yellowing, and leaf curling of young leaves. The inciting virus was easily transmitted by mechanical inoculation and by the whitefly Bemisia tabaci in a semi-persistent manner. The host range of the virus was restricted to two cucurbit species. Leaf dip preparations contained few flexuous particles about 700 to 750 nm long. Pinwheel-like inclusion bodies were observed in thin sections of diseased squash tissues. Serological tests by enzyme-linked immunosorbent assay showed that the virus is serologically related to watermelon mosaic virus-2, but not to zucchini yellow mosaic virus or papaya ring spot virus (watermelon strain). In view of these properties, this virus is considered to be a newly described virus and is tentatively named squash yellow leaf curl virus.

scholarly journals Occurrence of Maize rayado fino virus in Maize in Argentina

Plant Disease ◽  
2000 ◽  
Vol 84 (9) ◽  
pp. 1046-1046 ◽  
Author(s):  
M. P. Giménez-Pecci ◽  
E. Oliveira ◽  
R. Resende ◽  
C. Borgogno ◽  
C. F. Nome ◽  
...  
Keyword(s):  
Enzyme Linked Immunosorbent Assay ◽  
Plant Tissues ◽  
Rt Pcr ◽  
Xylem Parenchyma ◽  
Chain Reaction ◽  
Polymerase Chain ◽  
Maize Rayado Fino Virus ◽  
Size Relation ◽  
Pcr Conditions ◽  
Das Elisa

Symptoms of fine chlorotic stipple-striping of the veins, chlorosis, numerous dots and stripes, formation of holes in the leaf blade, and ears reduced in size, bearing few grains, were observed in maize crops in Tafí del Valle (Tucumán Province), Orán, El Galpón (Salta Province), Tilcara and Yaví (Jujuy Province), the subtropical area of northwest Argentina where the leafhopper vector Dalbulus maidis (DeLong & Wolcott) is present. Maize rayado fino virus (MRFV) was detected in these samples by a positive reaction in double antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) using an AGDIA kit. Electron microscopy revealed abundant isometric particles about 30 nm in diameter in the cytoplasm and vacuoles of phloem cells and xylem parenchyma cells. The virus was also detected by reverse transcription polymerase chain reaction (RT-PCR) using a primer pair MRFV-09/MRFV-10. Primers and PCR conditions were as previously described (1). Virus amplification was observed only in samples from symptomatic plants. In 1981 (2), the presence of MRFV in Argentina was revealed by serological assay in plants from temperate central areas. No further reports were released since then. This is the first evidence of MRFV in subtropical areas of Argentina and identification of the virus by combining DAS-ELISA, particle size, relation with plant tissues, and RTPCR. References: (1) R. W. Hammond et al. J. Gen. Virol. 78:3153, 1997. (2) S. F. Nome et al. RIA XIX:257, 1984.

First Detection of Tobacco Mosaic Virus in Tobacco Fields in Northern Lebanon

2020 ◽  
Vol 20 ◽  
Author(s):  
Rami Obeid ◽  
Elias Wehbe ◽  
Mohamad Rima ◽  
Mohammad Kabara ◽  
Romeo Al Bersaoui ◽  
...  
Keyword(s):  
Tobacco Mosaic Virus ◽  
Mosaic Virus ◽  
Viral Genome ◽  
Virus Genome ◽  
Enzyme Linked Immunosorbent Assay ◽  
Virus Family ◽  
Crop Fields ◽  
Wide Range ◽  
Almost All ◽  
Das Elisa

Background: Tobacco mosaic virus (TMV) is the most known virus in the plant mosaic virus family and is able to infect a wide range of crops, in particularly tobacco, causing a production loss. Objectives: Herein, and for the first time in Lebanon, we investigated the presence of TMV infection in crops by analyzing 88 samples of tobacco, tomato, cucumber and pepper collected from different regions in North Lebanon. Methods: Double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), revealed a potential TMV infection of four tobacco samples out of 88 crops samples collected. However, no tomato, cucumber and pepper samples were infected. The TMV+ tobacco samples were then extensively analyzed by RT-PCR to detect viral RNA using different primers covering all the viral genome. Results and Discussion: PCR results confirmed those of DAS-ELISA showing TMV infection of four tobacco samples collected from three crop fields of North Lebanon. In only one of four TMV+ samples, we were able to amplify almost all the regions of viral genome, suggesting possible mutations in the virus genome or an infection with a new, not yet identified, TMV strain. Conclusion: Our study is the first in Lebanon revealing TMV infection in crop fields, and highlighting the danger that may affect the future of agriculture.

Sign in / Sign up

Export Citation Format

Share Document