First report of peach powdery mildew caused by Podosphaera leucotricha in Japan

2020 ◽  
Vol 86 (4) ◽  
pp. 267-272
Author(s):  
S. YOKOSAWA ◽  
K. OKAZAWA ◽  
N. EGUCHI
Keyword(s):  
Powdery Mildew ◽  
Podosphaera Leucotricha ◽  
First Report

scholarly journals First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America

Plant Disease ◽  
2010 ◽  
Vol 94 (2) ◽  
pp. 279-279 ◽  
Author(s):  
A. M. Minnis ◽  
A. Y. Rossman ◽  
D. L. Clement ◽  
M. K. Malinoski ◽  
K. K. Rane
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Dna Sequence ◽  
Sequence Data ◽  
Its Region ◽  
Podosphaera Leucotricha ◽  
First Report ◽  
Pyrus Calleryana ◽  
Dna Sequence Data ◽  
Callery Pear

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana ‘Cleveland Select’ showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5′-3′ ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana ‘Chanticleer’, in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

scholarly journals First Report of Powdery Mildew on Pyrus calleryana Caused by Podosphaera leucotricha

Plant Disease ◽  
2008 ◽  
Vol 92 (1) ◽  
pp. 176-176 ◽  
Author(s):  
L. Vajna ◽  
L. Kiss
Keyword(s):  
Powdery Mildew ◽  
Urban Areas ◽  
Its Sequence ◽  
Podosphaera Leucotricha ◽  
Powdery Mildew Fungus ◽  
First Report ◽  
Host Genus ◽  
Pyrus Calleryana ◽  
Single Leaf ◽  
Leaf Surfaces

Callery pear (Pyrus calleryana Decne.) is native to Asia and its varieties are planted as ornamentals in urban areas worldwide. It is also used as a source of resistance to fireblight in some breeding programs. In April 2007, symptoms of powdery mildew infection were observed on the foliage of almost every P. calleryana cv. Chanticleer tree planted along a 1.5-km road in Budapest, Hungary. These trees were planted 5 to 6 years ago and were the first callery pears used as ornamentals in Hungary. Powdery mildew infections were also detected on P. calleryana trees planted in other parts of the city. White powdery mildew mycelium appeared on the lower and sometimes upper leaf surfaces, especially on young shoots, and caused chlorotic spots on the upper leaf surfaces and severe distortions of leaves. The spread of the infection was monitored between April and August of 2007 in several sample sites. More than 100 trees that were examined became heavily infected by May 2007. Powdery mildew conidiophores were typical of the genus Oidium subgen. Fibroidium, the anamorph of the teleomorph genus Podosphaera (2). Conidia developed in chains, contained fibrosin bodies, germinated at one of their ends with germ tubes terminating in unlobed appressoria, and measured 16 to 27 × 10 to 15 μm. Hyphal appressoria were nipple shaped or inconspicuous. The teleomorph was not found. To precisely identify the pathogen, DNA was extracted from conidia collected with a sterile brush from a single leaf using a Qiagen DNeasy Plant Kit (Hilden, Germany), and the internal transcribed spacer (ITS) sequence of the ribosomal DNA was amplified and determined as described by Szentiványi et al. (3). The ITS sequence, deposited in GenBank under Accession No. EU148597, was identical to those determined in Podosphaera leucotricha (Ell. & Ev.) Salmon collected from apple in Australia (GenBank Accession No. AF073353) and Canada (GenBank Accession No. AY157844) and also from pear in Canada (GenBank Accession No. AY157845). Thus, the pathogen was identified as Podosphaera leucotricha on the basis of the host genus, morphology of the anamorph, and ITS sequence. Specimens were deposited under Accession No. BPI878262 at the U.S. National Fungus Collection. To our knowledge, Podosphaera leucotricha has not been reported on P. calleryana in any parts of the world so far. An Oidium sp. infecting this plant in Australia was listed by Amano (1), but the exact identity of that fungus is not known. Thus, this is the first report of an identified powdery mildew fungus on P. calleryana. References: (1) K. Amano. Host Range and Geographical Distribution of the Powdery Mildew Fungi. Japan Scientific Societies Press, Tokyo, 1986. (2) U. Braun et al. Pages 13-55 in: The Powdery Mildews: A Comprehensive Treatise. R. R Bélanger et al., eds. American Phytopathological Society, St Paul, MN, 2002. (3) O. Szentiványi et al. Mycol. Res. 109:429, 2005.

scholarly journals First Report of Powdery Mildew Caused by Podosphaera leucotricha on Prunus africana in Kenya

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1285-1285 ◽  
Author(s):  
E. J. M. Mwanza ◽  
S. K. Waithaka ◽  
S. A. Simons
Keyword(s):  
Powdery Mildew ◽  
East African ◽  
Podosphaera Leucotricha ◽  
First Report ◽  
Prunus Africana ◽  
Conidial State ◽  
General Decline ◽  
National Museums ◽  
Uninoculated Control ◽  
International Mycological Institute

Prunus africana, formerly known as Pygeum africanum, is widely distributed in moist, tropical Africa and produces durable timber. Extracts from its bark are used in treatment of prostate disorders. Powdery mildew was observed on nursery-grown seedlings of P. africana in Kenya (Nyeri, Kiambu, and Kericho districts) in the dry seasons of 1998, 1999, and 2000. White ectotrophic mycelial growth was observed on leaves. The fungus caused stunting, distortion of leaves, surface necrosis of invaded tissues, and general decline in growth of seedlings that led to premature leaf fall and death. Invaded leaflets wilted and dropped, leaving behind a bare stem. The primary mycelium was hyaline, with no secondary brown mycelium. The conidial state was conspicuous, with conidia produced in chains. Appressoria were unlobed and nipple shaped. Conidiophores were straight and three-celled, measuring 75 to 112 μm. Conidiophore foot cells were topped by a longer cell and one or two shorter cells measuring 35 to 77 μm. Conidia had fibrosin bodies, were ovoid, and measured 27 to 30 × 17 to 18 μm. The fungus was identified by the International Mycological Institute IMI (W6496) as Podosphaera leucotricha (Ellis & Everh.) E. S. Salmon. Infected leaves of P. africana were deposited at the East African Herbarium, National Museums of Kenya (Accession No. KM-KEFRI/446/2001). Pathogenicity was confirmed by inoculating seedlings of P. africana by gently pressing infected leaves with abundant sporulation onto healthy leaves. The plants were then incubated under moist conditions for 48 h and thereafter maintained in a glasshouse. After 15 days, powdery mildew symptoms developed on seedlings. Examination of leaves confirmed that they were infected with Podosphaera leucotricha. Uninoculated control plants were free of powdery mildew. To our knowlege, this is the first report of Podosphaera leucotricha as a pathogen of P. africana. Reference: 1. H. J. Boesewinkel. Bot. Rev. 46:167, 1980.

scholarly journals First Report of Powdery Mildew Caused by Podosphaera leucotricha on Photinia × fraserii in Italy

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1362-1362
Author(s):  
A. Garibaldi ◽  
G. Gilardi ◽  
M. L. Gullino
Keyword(s):  
Powdery Mildew ◽  
Morphological Characteristics ◽  
The United States ◽  
Pathogenicity Test ◽  
Podosphaera Leucotricha ◽  
Public Park ◽  
First Report ◽  
Golden Delicious ◽  
Young Leaves ◽  
Voucher Specimens

Photinia × fraserii, belonging to the family Rosaceae, is an evergreen shrub used in parks and gardens. During the spring of 2004, severe outbreaks of a previously unknown powdery mildew were observed in a public park at Torino (northern Italy) on established plantings of this species. The adaxial and abaxial surfaces of leaves were covered with white mycelium and conidia. Stems also had signs of powdery mildew and were chlorotic. As the disease progressed, infected leaves turned yellow and abscised. Conidia formed in chains and were hyaline, ellipsoid, and measured 16.8 to 33.6 × 12.0 to 24.0 μm (average 25.6 × 15.6 μm). On the basis of host, morphological characteristics, and the presence of fibrosin bodies, the pathogen was identified as Podosphaera leucotricha (Ellis & Everth.) E.S. Salmon (2). Pathogenicity was confirmed by inoculating young leaves of 2-year-old Photinia × fraserii plants with a spore suspension (3 × 105 spores per ml). Also, three 3-year-old cv. Golden Delicious potted apple plants were inoculated. Three noninoculated Photinia × fraserii and three noninoculated apple plants sprayed with deionized water served as a control. After inoculation, plants were maintained in a growth chamber at 25°C. After 17 days, powdery mildew symptoms were observed on inoculated plants of Photinia × fraserii and cv. Golden Delicious. Noninoculated plants remained healthy. The pathogenicity test was carried out twice. The pathogenicity on apple supported the identification of the pathogen as P. leucotricha. To our knowledge, this is the first report of powdery mildew on Photinia × fraserii in Italy. P. leucotricha was previously described on Photinia serrulata in Italy (1) and the United States (3). Voucher specimens are available at the AGROINNOVA Collection, University of Torino. References: (1) E. Baldacci. Rev. Appl. Mycol. 16:358, 1937. (2) R. T. A. Cook et al. Mycol. Res. 101:975, 1997. (3) J. A. Milbraith. Rev. Appl. Mycol. 17:751, 1938.

First Report of Powdery Mildew of Kalanchoe blossfeldiana caused by Sphaerotheca fuliginea (Podosphaera fuliginea) in the Pacific Northwest

2003 ◽  
Vol 4 (1) ◽  
pp. 39
Author(s):  
Dean A. Glawe ◽  
Rita Hummel ◽  
Grace Jack
Keyword(s):  
Powdery Mildew ◽  
Pacific Northwest ◽  
Sphaerotheca Fuliginea ◽  
First Report ◽  
Major Disease ◽  
The Pacific ◽  
Kalanchoe Blossfeldiana ◽  
Extension Center ◽  
Kalanchoë Blossfeldiana

Kalanchoe blossfeldiana Poelln. is a common ornamental houseplant. Although powdery mildew is a major disease of this species, there are no published reports of it in the Pacific Northwest. In August, 2002, powdery mildew was observed on six indoor K. blossfeldiana plants in an office and adjacent laboratory at the Puyallup Research and Extension Center. Accepted for publication 25 March 2003. Published 17 April 2003.

scholarly journals First report of Podosphaera pannosa causing powdery mildew on Rosa chinensis in Brazil

2020 ◽  
Vol 102 (3) ◽  
pp. 933-933
Author(s):  
Wéverson Lima Fonseca ◽  
José Emilson Cardoso ◽  
Cristiano Souza Lima ◽  
Francisco Marto Pinto Viana ◽  
Márcio Akio Ootani ◽  
...  
Keyword(s):  
Powdery Mildew ◽  
First Report ◽  
Rosa Chinensis

scholarly journals Further Support of Conspecificity of Oak and Mango Powdery Mildew and First Report of Erysiphe quercicola and Erysiphe alphitoides on Mango in Mainland Europe

Plant Disease ◽  
2017 ◽  
Vol 101 (7) ◽  
pp. 1086-1093 ◽  
Author(s):  
Marie-Laure Desprez-Loustau ◽  
Marie Massot ◽  
Nicolas Feau ◽  
Tania Fort ◽  
Antonio de Vicente ◽  
...  
Keyword(s):  
Powdery Mildew ◽  
Host Range ◽  
Molecular Mechanisms ◽  
Single Copy ◽  
Broad Host Range ◽  
First Report ◽  
Erysiphe Quercicola ◽  
Powdery Mildews ◽  
Mango Leaves ◽  
Practical Implications

Mango leaves and inflorescences infected by powdery mildew in southern Spain were analyzed using multigene sequencing (ITS + 4 single-copy coding genes) to identify the causal agent. Erysiphe quercicola was detected in 97% out of 140 samples, collected in six different orchards in the Malaga region. Among these, a small proportion also yielded E. alphitoides (8% of all samples) and E. alphitoides was found alone in 3% of samples. A phylogenetic approach was completed by cross inoculations between oak and mango, which led to typical symptoms, supporting the conspecificity of oak and mango powdery mildews. To our knowledge, this is the first report of E. quercicola and E. alphitoides causing powdery mildew on mango trees in mainland Spain, and thus mainland Europe, based on unequivocal phylogenetic and biological evidence. Our study thus confirmed the broad host range of both E. quercicola and E. alphitoides. These results have practical implications in terms of the demonstrated ability for host range expansion in powdery mildews. They also open interesting prospects to the elucidation of molecular mechanisms underlying the ability to infect single versus multiple and unrelated host plants since these two closely related powdery mildew species belong to a small clade with both generalist and specialist powdery mildews.

First Report of Powdery Mildew of Lycium chinense (Chinese Matrimony Vine) Caused by Arthrocladiella mougeotii in the Pacific Northwest

2004 ◽  
Vol 5 (1) ◽  
pp. 16
Author(s):  
Dean A. Glawe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
Medicinal Plant ◽  
Pacific Northwest ◽  
Morphological Features ◽  
Lycium Chinense ◽  
First Report ◽  
Landscape Plant ◽  
The Pacific ◽  
Plant Grown

Chinese matrimony-vine (Lycium chinense Mill.) is a traditional medicinal plant grown in China and used as a perennial landscape plant in North America. This report documents the presence of powdery mildew on L. chinense in the Pacific Northwest and describes and illustrates morphological features of the causal agent. It appears to be the first report of a powdery mildew caused by Arthrocladiella in the Pacific Northwest. Accepted for publication 10 November 2004. Published 8 December 2004.

Sign in / Sign up

Export Citation Format

Share Document