scholarly journals CONTAMINATION OF WHITE CLOVER SEED CROPS BY BURIED SEEDS

1985 ◽  
Vol 2 ◽  
pp. 61-65
Author(s):  
J. A. Lancashire ◽  
M.P. Ralston ◽  
D.J. Scott
Keyword(s):  
New Zealand ◽  
White Clover ◽  
Picric Acid ◽  
Morphological Characteristics ◽  
Leaf Size ◽  
Genetic Contamination ◽  
Buried Seed ◽  
Growth Scores ◽  
Clover Seed ◽  
Seed Crops

Thirty five certified seed lines of 'Grasslands Pitau' white clover produced under OECD rules showed marked variations in growth and morphological characteristics according to their region of origin. Of lines grown in Oamaru district, South Canterbury, 90% were significantly different from a Pitau breeders (pre-basic) line in winter growth scores, leaf size and picric acid scores. 90% of lines grown in Marlborough were similar to a Pitau breeders line. Buried white clover seed counts were 260/m' (2 kg/ha) in Marlborough and 1060/m (7.5 kg/ha) in Oamaru. Plants grown from buried seed collected in Canterbury generally had smaller leaves, less winter growth and lower picric acid scores than Pitau. The additional possibility that natural selection of genotypes occurred because some crops of Pitau have been grown under climates and/or managements to which it is not adapted, is also discussed. Preliminary studies of 43 commercial lines of 15 cultivars from 4 countries grown outside New Zealand indicated that 3540% showed significant differences in winter growth and leaf size between lines of the same cultivar. New Zealand grown commercial lines of Huia obtained overseas showed good uniformity. It appears that there is a world-wide problem of genetic contamination in white clover cultivars. High buried seed loads are a potential long term source of contamination which is being exaggerated by the increasing numbers of cultivars. New Zealand has already moved to implement tighter certification standards than those recommended by OECD. Keywords: Trifolium repens, 'Grasslands Pitau', buried seed, seed certification, OECD, genetic contamination.

scholarly journals Trends in the global marketing of white clover cultivars

1996 ◽  
Vol 6 ◽  
pp. 7-14
Author(s):  
R.D.J. Mather ◽  
D.T. Melhuish ◽  
M. Herlihy
Keyword(s):  
New Zealand ◽  
South America ◽  
White Clover ◽  
Trifolium Repens ◽  
Western Europe ◽  
Leaf Size ◽  
Global Market ◽  
Production Region ◽  
Trifolium Repens L ◽  
Clover Seed

White clover (Trifolium repens L.) is the dominant legume of temperate pastures, having been improved by breeding since the 1930s. The 1994 OECD Register lists 93 cultivars, with a further 25-30 cultivars also known to commerce. Therefore, in excess of 100 cultivars are available to fulfil a world annual market of 8500-10,500 MT. Globally, New Zealand is the major white clover production region, providing 50- 55% of the seed. Other key production regions are Denmark, USA and South America. Consumption of white clover has been relatively static for some time, ranging from 8000-10,000 MT per annum. Between 55-60% of the seed is used in the northern hemisphere (approx. 40% by Western Europe - UK, France, Germany). USA, South America and New Zealand all consume similar tonnages annually (approx. 1000-2000 MT each) with smaller tonnages used in Australia. One cultivar, Grasslands Huia, has dominated the world white clover seed market for many years and it still remains the world's major cultivar by volume. However, in the last 10 years its position has come under increasing pressure from New Zealand and international proprietary cultivars. Eventually proprietary cultivars with improved agronomic performance will supersede the consumption of commodity/public white clovers in those countries where national listing is required to obtain release and recommended listing is need to ensure successful marketing. Despite this, Grasslands Huia will continue for many years to play a major role in supplying markets where national listing is not a prerequisite to release and price is a major factor in purchase decisions. Keywords: commodity cultivar, global market, Grasslands Huia, leaf size, market share, production trends, proprietary cultivar, seed industry, Trifolium repens L., white clover

scholarly journals POSSIBLE SOLUTIONS TO CONTAMINATION OF WHITE CLOVER SEED CROPS BY BURIED SEED

1985 ◽  
Vol 2 ◽  
pp. 67-73
Author(s):  
P.T.P. Clifford ◽  
M.P. Rolston ◽  
W.M. Williams
Keyword(s):  
White Clover ◽  
Trifolium Repens ◽  
Cultural Practices ◽  
Seeding Rate ◽  
Hard Seed ◽  
Hard Seeds ◽  
Buried Seed ◽  
Trifolium Repens L ◽  
Clover Seed ◽  
Seed Crops

Buried hard seed from seed returned to the soil during harvesting and incorporated by cultivation, poses the greatest threat of contamination. When a different white clover (Trifolium repens L.) is sown, contamination will occur when hard seeds within the germinating zone soften and emerge. Harvest losses can return 40 to 210 kg/ha of hard seeds to the soil. Flowering management and efficient harvesting are necessary to minimise quantities of hard seed returned to the soil. For a buried seed load of 845/m* in the germinating zone of a cultivated seed bed at sowing in March, 8% of that seed load gave rise to establishing plants of which one-third (19/m') were surviving in mid-October. At closing the percentage crop contamination within the sown row was directly proportional to the within-row seeding rate of the sown cultivar. At wider-than-normal row spaces, (45 cm compared with 15 cm) either inter-row cultivation or spraying for removal of contaminants was necessary at closing to reduce contaminants to a density similar to that in 15 cm spacing treatments. Physical contamination of the harvested seedline, compared with levels present at closing, had doubled for normal, but trebled for wider-than-normal spacings. Lowest percentage physical contamination of a seedline gained was 13% for a 6 kg/ha seeding at 15 cm spacings. The results indicate that successful cultivar change on many areas will be difficult. A buried seed count is considered an essential guideline to aid choice of paddock. Future management systems now being developed, include the use of herbicides and direct drilling, and should help to minimise this problem. Keywords: White clover, Trifolium repens, seed production, contamination, cultivar change, harvest losses, hard seed, cultural practices.

scholarly journals Contamination of white clover seed crops by buried seed

1992 ◽  
pp. 139-141
Author(s):  
J.G.H. White ◽  
G.R. Edwards ◽  
K. Nicholson
Keyword(s):  
White Clover ◽  
Burial Depth ◽  
Hard Seed ◽  
Seed Loss ◽  
Cultivation Practices ◽  
Buried Seed ◽  
Direct Drilling ◽  
Clover Seed ◽  
Seed Crops ◽  
Practical Implications

The first study examined white clover seed loss in the offal trail of a header harvester. Seed counts in offal trails were 83 800/m* compared to intermediate areas at 22 500/m*. Consequent problems in sampling for buried seed are discussed. The second trial measured buried seed two years after a white clover seed crop. In the top 25 cm of soil 66 200 seeds/m* remained following conventional cultivation but only 26 000 occurred under direct drilling. With conventional cultivation 80% of seed was buried below 10 cm depth, but 63% of the buried seed was in the O-5 cm layer with direct drilling. In a third study the rate of hard seed breakdown was examined. Breakdown was rapid on the surface but after4 years 36% of seed survived at 10 cm depth and 65% at 20 cm buried. The practical implications on cultivation practices required to permit change of cultivars without contamination problems are discussed. Keywords Trijblium repens L., buried seed, offal trail, direct drill, conventional cultivation, burial depth

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals The intensifying requirements for white clover cultivar change

1996 ◽  
Vol 6 ◽  
pp. 19-24
Author(s):  
P.T.P. Clifford ◽  
G.A. Sparks ◽  
D.R. Woodfield
Keyword(s):  
New Zealand ◽  
White Clover ◽  
Pollen Deposition ◽  
Foreign Pollen ◽  
Buried Seed ◽  
Environmental Requirements ◽  
Trifolium Repens L ◽  
Isolation Distances ◽  
Seed Yields ◽  
Break Period

For the last five years an average 14,761 ha of white clover has been grown for seed, with 77%, 8% and 15% sown in public cultivars, New Zealand and overseas proprietary cultivars, respectively. The area presently contaminated by proprietaries is estimated at 20,000 ha. New Zealand requirements for cultivar-change are more effective than OECD requirements. The five-year break period enables successful cultivar change in 90% of cases and is improved further when buried seed counts were used prior to sowing to indicate paddocks with unacceptable buried seed load. Current isolation distances appear adequate with virtually all foreign pollen deposition occurring within 24m of the pollen source. Capture of additional public cultivar area (77%) by proprietary cultivars will rely on increasing the seed yields of proprietary cultivars by approximately 25%. This is realisable through greater attention to the environmental requirements of each cultivar and through better technology transfer between head licencees and growers. Keywords: buried seed, crop areas, cultivar-change requirements, public cultivars, proprietary cultivars, seed production, Trifolium repens L., white clover

scholarly journals The key to successful second year white clover seed crops

1996 ◽  
Vol 6 ◽  
pp. 40-40
Author(s):  
B.L. Mccloy ◽  
S.R. White
Keyword(s):  
Seed Yield ◽  
White Clover ◽  
Block Design ◽  
First Year ◽  
Flower Number ◽  
Mature Flower ◽  
Second Year ◽  
Clover Seed ◽  
Seed Crops ◽  
Rotary Type

In recent years there has been an increase in the number of white clover seed crops taken for a second harvest. Traditionally yields from second year crops are substantially lower than first year crops. A trial was established investigating techniques to increase yields in second year crops. The trial was located in a dryland crop of white clover (cv. Grasslands Demand) 4 km east of Methven, mid Canterbury. It involved 10 herbicide treatments and 8 'inter-row' treatments arranged in a split block design. Number of mature flower heads were recorded on all treatments at harvest as an indirect estimate of yield. Additionally, selected treatments were cut and collected using a rotary type mower, threshed, and machine dressed for direct estimates of seed yield. Flower number and machine dressed seed yield were significantly (P

Sign in / Sign up

Export Citation Format

Share Document