Neolithic Rice Cultivation and Consequent Landscape Changes at the Baodun Site, Southwestern China

Identifying when agricultural expansion has occurred and how it altered the landscape is critical for understanding human social survival strategies as well as current ecological diversity. In the present study, phytolith records of three profiles from the Baodun site area were dated to the period from 7,500 to 2,500 aBP by optically stimulated luminescence and 14C dating, providing the first evidence that the Asian cultivated rice (Oryza sativa) progenitor was distributed in the Chengdu Plain as early as 7,500 aBP. The percentage of rice bulliform with ≥9 scales and the concentration of rice phytoliths sharply increased by approximately 4,200 aBP, suggesting that rice cultivation occupied a dominant position in survival strategy no later than approximately 4,200 aBP, which might be driven by climate deterioration in eastern China. The results further showed that the proportion of Bambusoideae phytoliths increased synchronously with the increase in the proportion of rice phytoliths, suggesting that the vegetation structure near the site was changed intentionally as a consequence of increasing rice agricultural activity since 4,200 aBP. The present study contributes to a deeper understanding of the distribution of wild rice and rice farming throughout the Baodun culture in the Chengdu Plain, and it also provides a glimpse of how humans intentionally changed the vegetation landscape on a local scale.

Download Full-text

Impacts of Agricultural Land Acquisition for Urbanization on Agricultural Activities of Affected Households: A Case Study in Huong Thuy Town, Thua Thien Hue Province, Vietnam

Sustainability ◽

10.3390/su13158559 ◽

2021 ◽

Vol 13 (15) ◽

pp. 8559

Author(s):

Nhung Pham Thi ◽

Martin Kappas ◽

Heiko Faust

Keyword(s):

Agricultural Development ◽

Agricultural Land ◽

Rice Cultivation ◽

Mixed Data ◽

Land Acquisition ◽

Agricultural Activity ◽

Agricultural Activities ◽

Farmland Abandonment ◽

Before And After ◽

The Government

Agricultural land acquisition for urbanization (ALAFU) has strongly impacted agriculture in Vietnam during the last decades. Given the mixed data obtained from a survey with 50 households who lost 50% of their farmland area (in-depth interviews, a group-focused discussion and observation) this study shows the different impacts of ALAFU on each agricultural activity of affected household by comparing before and after ALAFU. Rice cultivation and animal breeding have sharply declined, but potted flower plantation (PFP) has quickly grown and is the main income of 34% of surveyed households. Rice cultivation has declined not only as a result of agricultural land acquisition, which has resulted in the loss of rice land, but also as a result of urbanization, which has resulted in rice land abandonment. Conversely, PFP is growing due to advantages associated with urbanization, such as a good consumer market and upgraded infrastructure. However, whether they are declining or increasing, all agricultural activities have to face challenges related to the shortcomings in agricultural land allocation and agricultural development plans. This study suggests that if ALAFU projects are continued, the government should evaluate agricultural development and forecast farmland abandonment after ALAFU. Simultaneously, they should put more effort into maintaining agriculture in the form of peri-urban or urban agriculture, which is significant for sustainable development in affected communities.

Download Full-text

Presumed domestication? Evidence for wild rice cultivation and domestication in the fifth millennium BC of the Lower Yangtze region

Antiquity ◽

10.1017/s0003598x0009520x ◽

2007 ◽

Vol 81 (312) ◽

pp. 316-331 ◽

Cited By ~ 161

Author(s):

Dorian Q Fuller ◽

Emma Harvey ◽

Ling Qin

Keyword(s):

Wild Rice ◽

Early to middle Holocene rice cultivation in response to coastal environmental transitions along the South Hangzhou Bay of eastern China

Palaeogeography Palaeoclimatology Palaeoecology ◽

10.1016/j.palaeo.2020.109872 ◽

2020 ◽

Vol 555 ◽

pp. 109872 ◽

Cited By ~ 1

Author(s):

Yan Liu ◽

Lanjie Deng ◽

Jin He ◽

Ren Jiang ◽

Daidu Fan ◽

...

Keyword(s):

Eastern China ◽

Rice Cultivation ◽

Hangzhou Bay ◽

The South ◽

Middle Holocene ◽

Environmental Transitions

Download Full-text

Site of Baodun yields earliest evidence for the spread of rice and foxtail millet agriculture to south-west China

Antiquity ◽

10.1017/s0003598x00049449 ◽

2013 ◽

Vol 87 (337) ◽

pp. 758-771 ◽

Cited By ~ 28

Author(s):

Jade d'Alpoim Guedes ◽

Ming Jiang ◽

Kunyu He ◽

Xiaohong Wu ◽

Zhanghua Jiang

Keyword(s):

Foxtail Millet ◽

Agricultural History ◽

Rice Cultivation ◽

West China ◽

Farming Communities ◽

Chengdu Plain ◽

South West ◽

Plant Remains ◽

Type Site ◽

Millet Agriculture

The Chengdu plain of south-west China lies outside the main centres of early domestication in the Huanghe and Yangzi valleys, but its importance in Chinese prehistory is demonstrated by the spectacular Sanxingdui bronzes of the second millennium BC and by the number of walled enclosures of the third millennium BC associated with the Baodun culture. The latter illustrate the development of social complexity. Paradoxically, however, these are not the outcome of a long settled agricultural history but appear to be associated with the movement of the first farming communities into this region. Recent excavations at the Baodun type site have recovered plant remains indicating not only the importance of rice cultivation, but also the role played by millet in the economy of these and other sites in south-west China. Rice cultivation in paddy fields was supplemented by millet cultivation in neighbouring uplands. Together they illustrate how farmers moving into this area from the Middle Yangzi adjusted their cultivation practices to adapt to their newly colonised territories.

Download Full-text

Optically stimulated luminescence dating of loess in South-Eastern China using quartz and polymineral fine grains

Quaternary Geochronology ◽

10.1016/j.quageo.2021.101226 ◽

2021 ◽

pp. 101226

Author(s):

A. Avram ◽

D. Constantin ◽

Q. Hao ◽

A. Timar-Gabor

Keyword(s):

Eastern China ◽

Optically Stimulated Luminescence ◽

Luminescence Dating ◽

South Eastern ◽

Optically Stimulated Luminescence Dating

Download Full-text

Notes on the recent discovery of ancient cultivated rice at Jiahu, Henan Province: a new theory concerning the origin of Oryza japonica in China

Antiquity ◽

10.1017/s0003598x00087536 ◽

1998 ◽

Vol 72 (278) ◽

pp. 897-901 ◽

Cited By ~ 34

Author(s):

Zhang Juzhong ◽

Wang Xiangkun

Keyword(s):

Henan Province ◽

Yangtze River Valley ◽

River Valley ◽

Rice Cultivation ◽

Cultivated Rice ◽

Rice Agriculture ◽

The Holocene ◽

River Region ◽

Huai River ◽

History Of

China is one of the places for the origin of the Asian cultivated rice (Oka 1988), but there are different theories for precise locations where ancient cultivated rice first originated, including those proposing South China and Yunnan (Li 1989) or the middle and lower Yangtze River Valley (Yan 1989), or the middle Yangtze and the upper Huai River Valley (Wang 1996) as the site of the oldest rice cultivation in China. The discovery (Zhang et al. 1994) of ancient rice at Jiahu in Henan province not only pushed the history of rice agriculture in the Huai River region back to 9000 BP, but also indicated the existence of an agricultural tradition of rice cultivation in the region from the beginning of the Holocene Anathermal until the end of the Holocene megathermal.

Download Full-text

First Report of Rice yellow mottle virus in Rice in Uganda

Plant Disease ◽

10.1094/pd-90-0683b ◽

2006 ◽

Vol 90 (5) ◽

pp. 683-683 ◽

Cited By ~ 6

Author(s):

A. Pinel-Galzi ◽

D. Fargette ◽

R. Hull

Keyword(s):

Lake Victoria ◽

Sister Group ◽

Rice Cultivation ◽

Eastern Africa ◽

Mottle Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rice Yellow Mottle Virus ◽

Cultivated Rice ◽

Northern Tanzania ◽

Yellow Mottle

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa) is grown (2). During July 2000, plants with leaf yellowing and mottling symptoms were observed in Uganda in a subsistence rice field northeast of Lake Victoria, close to the Nile River. RYMV was detected by using enzyme-linked immunosorbent assay with polyclonal RYMV antisera (1) in the four samples collected. Discriminant monoclonal antibodies revealed that the samples contained RYMV serotype 4, a serotype found in eastern Africa (Madagascar, Kenya, and Tanzania) (2). The 720-nt long coat protein gene of two isolates was amplified by reverse transcriptase-polymerase chain reaction and sequenced (1). The two Ugandan isolates had 99% nt sequence identity (EMBL Accession Nos. AM114523 and AM114524). They belonged to a monophyletic group (97% nt identity) containing isolates from eastern Kenya and northern Tanzania (close to the Lake Victoria). These form a sister group (93% identity) of isolates from Lake Malawi Region in western Tanzania and are more distantly related (88% identity) to the basal strains from eastern Tanzania (2). Isolation of the Lake Victoria Region from the rest of the Tanzania by distance, physical barriers, and patchy rice cultivation explains the specificity of the strain. Year-round growth of wild and cultivated rice around the lake ensures host continuity in time and space that facilitates spread that accounts for the homogeneity of the isolates of this area. Knowledge of the presence of RYMV in Uganda is important since rice cultivation is intensified in this country and is planned in neighboring southern Sudan. References: (1) A. Pinel et al. Arch. Virol. 145:1621, 2000. (2) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Download Full-text

First Report of Rice yellow mottle virus on Rice in Burundi

Plant Disease ◽

10.1094/pdis-03-12-0293-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1230-1230 ◽

Cited By ~ 3

Author(s):

I. Ndikumana ◽

A. Pinel-Galzi ◽

Z. Negussie ◽

S. N'chimbi Msolla ◽

P. Njau ◽

...

Keyword(s):

Polyclonal Antibodies ◽

Disease Incidence ◽

Sandwich Elisa ◽

Rice Cultivation ◽

Mottle Virus ◽

Rice Yellow Mottle Virus ◽

Cultivated Rice ◽

Phylogenic Tree ◽

Northern Tanzania ◽

Yellow Mottle

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

Download Full-text