scholarly journals DNA Isolation And Amplification of the rbcL (ribulose-1,5- bisphosphate carboxylase/oxygenase large subunit) gene of Caulerpa sp., Gracilaria sp., And Sargassum sp.

2020 ◽  
Vol 8 (2) ◽  
pp. 214
Author(s):  
Biondi Tampanguma ◽  
Grevo S. Gerung ◽  
Veibe Warouw ◽  
Billy Th Wagey ◽  
Stenly Wulllur ◽  
...  
Keyword(s):  
Target Gene ◽  
Dna Isolation ◽  
Large Subunit ◽  
Dna Amplification ◽  
Ammonium Bromide ◽  
Rbcl Gene ◽  
Bisphosphate Carboxylase ◽  
Plant Dna ◽  
Ctab Method ◽  
Amplification Process

DNA isolation and gene amplification of algae are significantly influenced by various factors such as characteristics and components of the algae cell wall. Therefore techniques and methods of DNA isolation in certain algae, sometimes only succeed in one particular species and can not be applied to another algae species. Based on that issue, this study was conducted with the aims to determine the succeed of DNA isolation and amplify the rbcL gene as a target gene for identification. Algae DNA was isolated by using innuPrep Plant DNA commercial kit, and the second one with a modified conventional Cetyl Trimetyl Ammonium Bromide (CTAB) method,  for the amplification process was using rbcL gene (ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit) with two pairs of primers : rbcL 7F-753R and rbcL 577F-rbcSR. The results showed that the DNA of Gracilaria sp was succeed isolated by using CTAB method and it was denoted by the presence of DNA bands in agarose gel. Meanwhile DNA amplification for Gracilaria sp., and Sargassum sp., were succeed amplified with the appearance of DNA bands. But in algae Caulerpa sp., was only succeed on 1 pair of primary rbcL 7F and 7.Keywords : DNA, gene rbcL, algae Caulerpa sp., Sargassum sp., Gracilaria sp;AbstrakIsolasi DNA dan amplifikasi gen pada alga sangat dipengaruhi oleh beberapa faktor seperti karakter dan komponen pada dinding sel alga. Oleh karena itu proses isolasi DNA terkadang bisa berhasil pada satu jenis alga, namun tidak berhasil pada jenis alga lainnya. Oleh karena alasan tersebut, maka penelitian ini dilakukan untuk menentukan keberhasilan Isolasi DNA dan mengamplifikasi gen rbcL sebagai gen target identifikasi. Penelitian ini dilakukan dengan tahapan awal Isolasi DNA yang menggunakan kit komersil innuPrep Plant DNA Kit, dan metode konvensional Cetyl Trimetyl Ammonium Bromide (CTAB) yang telah dimodifikasi. Sedangkan untuk proses amplifikasi, menggunakan gen rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) digunakan dua pasang primer yaitu rbcL 7F-753R dan rbcL 577F-rbcSR. Hasil isolasi DNA dari alga Gracilaria sp berhasil diisolasi menggunakan metode CTAB yang ditandai dengan adanya pita DNA pada gel agarose. Amplifikasi DNA pada alga Gracilaria sp., dan Sargassum sp., berhasil diamplifikasi dengan munculnya pita DNA. Namun pada alga Caulerpa sp. hanya berhasil pada 1 pasang primer rbcL 7F dan753R.Kata kunci : DNA, gen rbcL, alga Caulerpa sp., Sargassum sp., Gracilaria sp.

scholarly journals DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency

2019 ◽  
Vol 6 (2) ◽  
pp. 33
Author(s):  
Irvan R Hengkengbala ◽  
Grevo S Gerung ◽  
Stenly Wullur
Keyword(s):  
Dna Extraction ◽  
Large Subunit ◽  
Extraction Procedure ◽  
Ammonium Bromide ◽  
Subunit Gene ◽  
Cetyltrimethyl Ammonium Bromide ◽  
Bisphosphate Carboxylase ◽  
Plant Dna ◽  
Cetyltrimethyl Ammonium ◽  
Solis Biodyne

Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae.  The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya.  Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33”E).  Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne).  Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.

Nucleotide sequences of rbcL confirm the capparalean affinity of the Australian endemis Gyrostemonaceae

1994 ◽  
Vol 7 (1) ◽  
pp. 57 ◽  
Author(s):  
JE Rodman ◽  
KG Karol ◽  
RA PRice ◽  
E Conti ◽  
KJ Systma
Keyword(s):  
Sequence Data ◽  
Stop Codon ◽  
Large Subunit ◽  
Cladistic Analysis ◽  
Sister Group ◽  
Nucleotide Sequences ◽  
Mustard Oil ◽  
Rbcl Gene ◽  
Bisphosphate Carboxylase ◽  
Weak Support

Nucleotide sequences (1452 base pairs) from the chloroplast gene for the large subunit of ribulose-1, 5-bisphosphate carboxylase/oxygenase (rbcL) were obtained for three species of Gyrostemon and Tersonia of the Australian endemic family Gyrostemonaceae. Phylogenetic reconstruction based on parsimony robustly allies the family with other mustard oil-producing plants in Dahlgren's expanded order Capparales. Within this clade, Gyrostemonaceae are the sister group to Resedaceae, but the sequence data provide only weak support for this particular linkage. The new molecular data corroborate recent embryological and ultrastructural findings for Gyrosternonaceae and confirm results from Rodman's cladistic analysis of traditional morphological features of these plants. The rbcL sequences for the three species of Gyrostemonaceae were consistent in possessing a stop codon ending at position 1452, well beyond the usual 1428 site for many dicots. An extended terminus for the rbcL gene appears to be a marker within the expanded order Capparales for a derived clade that comprises the traditional core Capparales (Brassicaceae, Capparaceae, Resedaceae and Tovariaceae) plus Gyrostemonaceae, the sister taxa Batis + Koeberlinia, and Limnanthaceae.

scholarly journals The perspectives for DNA barcoding of Rhaponticum carthamoides (Willd.) Iljin using rbcL gene sequence

2021 ◽  
Vol 908 (1) ◽  
pp. 012030
Author(s):  
M V Protopopova ◽  
N A Shvetsova ◽  
V V Pavlichenko
Keyword(s):  
Dna Barcoding ◽  
Large Subunit ◽  
Dna Barcode ◽  
Natural Populations ◽  
Rbcl Gene ◽  
Ribulose Bisphosphate Carboxylase ◽  
Bisphosphate Carboxylase ◽  
Rhaponticum Carthamoides ◽  
South Siberia ◽  
Illegal Harvesting

Abstract The methods of biological species identification using nucleotide sequences of short genome regions (DNA barcoding) are actively developed. The universal DNA barcode for plants remains to be discovered, and one of the leading candidates is the plastid gene of the large subunit of ribulose-bisphosphate carboxylase gene (rbcL). In our study, we estimated the part of rbcL gene as a possible marker for molecular identification of Rhaponticum carthamoides (Willd.) Iljin. Due to its officinal properties, the species is susceptible to uncontrolled and illegal harvesting from natural populations. Today, the species needs to be protected and therefore is included into the Red Data Books of the Russian Federation and certain regions. The study was carried out using plants from the natural populations sampled from the Khamar-Daban Ridge (South Siberia) and considering now as Rh. carthamoides var. chamarense (Peschkova) O S Zhirova. It was shown that rbcL gene can be used to identify Rh. carthamoides at least from the populations of the Khamar-Daban Ridge using a fragment of the maximum length or its 3’ region. Apparently, the 5’ region of the gene (rbcLa) most often used as DNA barcode for plants may be of lesser importance for Rh. carthamoides. The rbcL gene sequences can be also used for the development of approaches for Rh. carthamoides identification in the medicinal preparations and products containing dried tissues to prevent their falsification and illegal harvesting of this species. The combination of rbcL gene with additional markers seems to be highly desirable to create effective DNA barcodes for Rhaponticum species.

scholarly journals Chloroplast Genome Evolution in the Genus Avena

Genetics ◽  
1987 ◽  
Vol 116 (4) ◽  
pp. 613-621
Author(s):  
Koji Murai ◽  
Koichiro Tsunewaki
Keyword(s):  
Chloroplast Genome ◽  
Restriction Site ◽  
Physical Map ◽  
Fragment Size ◽  
Large Subunit ◽  
Single Copy ◽  
Rbcl Gene ◽  
Type I ◽  
Bisphosphate Carboxylase ◽  
Chloroplast Genomes

ABSTRACT The genus Avena contains five different chloroplast genomes, I-V. A physical map of chloroplast (ct) DNA of Avena sativa (type I chloroplast genome) was constructed using three restriction endonucleases, PstI, SalI and SmaI. This genome is ca. 135.5 kbp in size, and contains two inverted repeats of ca. 22.5 kbp each, separated by a large (ca. 79.0 kbp) and small (ca. 12.5 kbp) single copy region. The rbcL gene which codes for the large subunit of ribulose 1,5-bisphosphate carboxylase, was located in the map. Restriction fragment patterns of all five chloroplast genomes were compared, and among them five fragment size and five restriction site mutations were disclosed. Four site mutations were found in two or more chloroplast genomes, the other site and five fragment size mutations were specific to one or another of the chloroplast genomes. A dendrogram showing phylogenetic relationships among the five chloroplast genomes, based on the distribution of the common and specific mutations among them, indicates that chloroplast genome divergence characterized by three restriction site mutations occurred first between two diploid groups, each carrying A and C genome (nuclear), respectively, followed by further speciation in each group.

scholarly journals Molecular phylogenies support taxonomic revision of three species of Laurencia (Rhodomelaceae, Rhodophyta), with the description of a new genus

2017 ◽  
Author(s):  
Florence Rousseau ◽  
Delphine Gey ◽  
Akira Kurihara ◽  
Christine A. Maggs ◽  
Julie Martin-Lescanne ◽  
...  
Keyword(s):  
New Genus ◽  
Large Subunit ◽  
Taxonomic Revision ◽  
Sister Group ◽  
Rbcl Gene ◽  
Data Sets ◽  
Cortical Cells ◽  
Data Set ◽  
Bisphosphate Carboxylase ◽  
Rich Data

The systematics of the Laurencia complex was investigated using a taxon-rich data set including the chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene only and a character-rich data set combining mitochondrial cytochrome oxidase 1 (COI-5P), the rbcL marker, and the nuclear large subunit of the ribosomal operon (LSU). Bayesian and ML analyses of these data sets showed that three species hitherto placed in the genus Laurencia J.V.Lamour. were not closely related to Laurencia s. str. Laurencia caspica Zinova & Zaberzhinskaya was the sister group of the remaining Osmundea Stackh. species, L. crustiformans McDermid joined Palisada and L. flexilis Setch. consisted of an independent lineage. In light of these results a new genus, Ohelopapa F.Rousseau, Martin-Lescanne, Payri & L.Le Gall gen. nov., is proposed to accommodate L. flexilis. This new genus is morphologically characterized by four pericentral cells in each vegetative axial segment; however, it lacks ‘corps en cerise’ in cortical cells and secondary pit connections between cortical cells, which are characteristic of Laurencia. Three novel combinations are proposed to render the classification closer to a natural system: Ohelopapa flexilis (Setch.) F.Rousseau, Martin-Lescanne, Payri & L.Le Gall comb. nov., Osmundea caspica (Zinova & Zaberzhinskaya) Maggs & L.M.McIvor comb. nov. and Palisada crustiformans (McDermid) A.R.Sherwood, A.Kurihara & K.W.Nam comb. nov.

scholarly journals Can Biomarkers Respond Upon Freshwater Pollution?—A Moss-Bag Approach

Biology ◽  
2020 ◽  
Vol 10 (1) ◽  
pp. 3
Author(s):  
Gana Gecheva ◽  
Ivelin Mollov ◽  
Galina Yahubyan ◽  
Mariyana Gozmanova ◽  
Elena Apostolova ◽  
...  
Keyword(s):  
Large Subunit ◽  
Cell Number ◽  
Total Phenolic ◽  
Rbcl Gene ◽  
Leaf Cell ◽  
Fontinalis Antipyretica ◽  
Bisphosphate Carboxylase ◽  
Freshwater Pollution ◽  
Aquatic Mosses ◽  
Moss Bags

Moss-bags were applied to study the effect of contamination in three standing water bodies in Bulgaria (Kardzhali, Studen Kladenets and Zhrebchevo Reservoirs), the first two with old industrial contamination and the last polluted with short-chain chlorinated paraffins (SCCPs). Fontinalis antipyretica Hedw. collected from background (unpolluted) site was placed in cages for a period of 30 days. The present study examined whether inorganic and organic pollution detected with moss-bags resulted in corresponding differences in molecular, chemical and micromorphological markers. Suppressed large subunit of ribulose-1,5-bisphosphate carboxylase (rbcL) expression was assessed in moss-bags from two of the reservoirs, contaminated with heavy metals. There was a decrease of the total phenolic content (TPC) in the moss-bags, which provides a basis for further studies of the chemical content of aquatic mosses. Fontinalis antipyretica also showed a response through leaf micromorphological characteristics. In the all three reservoirs, an increase of the twig leaf cell number was recorded (p ≤ 0.01 for Kardzhali and p ≤ 0.001 for Studen Kladenets and Zhrebchevo reservoirs), as well as of the stem leaf cell number in Zhrebchevo Reservoir (p ≤ 0.001). On the contrary, the width of the cells decreased in the studied anthropogenically impacted reservoirs. All three studied groups of biomarkers (molecular, chemical and micromorphological) appeared to be sensitive to freshwater pollution. The results achieved indicated that rbcL gene expression, TPC, cell number and size are promising biomonitoring tools.

scholarly journals Analysis of Adaptive Evolution and Coevolution of rbcL Gene in the Genus Hildenbrandia (Rhodophyta)

2020 ◽  
Vol 16 ◽  
pp. 117693432097786
Author(s):  
Nan Fangru ◽  
Han Yuxin ◽  
Liu Xudong ◽  
Feng Jia ◽  
Lv Junping ◽  
...  
Keyword(s):  
Adaptive Evolution ◽  
Evolutionary History ◽  
Large Subunit ◽  
Purifying Selection ◽  
Dimensional Structure ◽  
Rbcl Gene ◽  
Bisphosphate Carboxylase ◽  
3 Dimensional ◽  
Grand Average ◽  
Tree Construction

The adaptive evolution and coevolution of the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit ( rbcL) gene in the genus Hildenbrandia were studied based on phylogenetic tree construction and the physicochemical properties and the secondary structures of protein encoded by rbcL (Rubisco large subunit) were analyzed. The amino acids compositions and grand average of hydropathicity of freshwater H. rivularis and marine H. rubra were similar. Rubisco large subunit of Hildenbrandia was hydrophilic and the secondary structure was primarily composed of α-helixes and β-sheets, revealing the relatively stable structure of this protein. The predicted phosphorylation sites in H. rivularis and H. rubra were 33 and 36, respectively. No positive selection sites were detected in the genus Hildenbrandia, implying that rbcL gene evolved either neutrally or under purifying selection. A total of 41 coevolutionary groups were detected in the Rubisco large subunit of Hildenbrandia and the coevolving sites are in closer proximity in 3-dimensional structure of the protein. Despite the long evolutionary history, rbcL gene in genus Hildenbrandia under different environments is rather conservative.

scholarly journals Uji Efektivitas Metode Isolasi DNA Genom Kopi Arabika (Coffea arabica L.) Asal Kabupaten Jayawijaya

2018 ◽  
Vol 8 (1) ◽  
Author(s):  
Arsyam Mawardi ◽  
Maria L. Simonapendi
Keyword(s):  
Genomic Dna ◽  
Dna Isolation ◽  
Dna Amplification ◽  
Initial Information ◽  
Arabica Coffee ◽  
Modified Method ◽  
Ctab Method ◽  
Young Leaves ◽  
Amplification Technique ◽  
The Difference

Genetic substance of DNA has many functions as a basic component of the organism. DNA can be obtained directly through the isolation of DNA. Isolation of genomic DNA Wamena arabica coffee is done by treating the young leaves to get DNA extract. This reasearch is intended to provide scientific contributions in an effort to screen the best methods of DNA isolation, including a modified extraction of Zheng et al method (2005), a modified method of Doyle and Doyle (1990), and method of George and Khan modificaation (2008) or CTAB method. All of methods were tested on Arabica coffee Jayawijaya Wamena. Testing was done by looking at the difference in quality and quantity of products in the form of genomic DNA concentration and DNA thickness, comparing with the marker DNA then electrophoresis on agarose gel. From the results of testing the effectiveness of three types of isolation methods, it was found that the method of George and Khan (2008) or CTAB genomic DNA  produce the best quality than other methods. In terms of quantity, the criteria in the form of DNA concentrations ranging from 100 ng λ-DNA/ml, λ-DNA 50 ng/ml, λ-DNA 10 ng/ml. Concentration of genomic DNA bands visible when the profile is visualized in gel electrophoresis with UV luminescence. This study will be a step and initial information about the genetic composition of a population of arabica coffee which still exists, and will be developed through DNA amplification technique. Key words: coffee, isolation of genomic DNA, CTAB method, profile band pattern

Sign in / Sign up

Export Citation Format

Share Document