scholarly journals Identifikasi sirip ikan hiu yang didapat dari pengumpul di Minahasa Tenggara menggunakan DNA Barcode

2017 ◽  
Vol 5 (1) ◽  
pp. 62
Author(s):  
Andre Wehantouw ◽  
Elvy Ginting ◽  
Stenly Wullur

Populasi ikan hiu global menunjukkan penurunan yang signifikan karena; penangkapan yang masif dan tak terkontrol, karakter biologi reproduksi yang lambat serta fekunditas yang rendah.  Indonesia merupakan salah satu negara kontributor terbesar dalam perdagangan sirip ikan hiu dunia. Tingginya aktifitas perdagangan sirip tersebut berpengaruh terhadap populasi ikan hiu dan berdampak pada turunnya kualitas keseimbangan ekosistem laut. Tujuan penelitian ini untuk mengidentifikasi ikan hiu dari potongan sirip yang didapat dari pengumpul di Tumbak, Minahasa Tenggara menggunakan DNA barcode.  Ekstraksi DNA genom sirip hiu kering dilakukan dengan menggunakan prosedur DNeasy Blood & Tissue kit, amplifikasi gen Cytochrome Oxidase Subunit 1 (COI) dilakukan dengan menggunakan primer Fish BCL5 (TCAACYAATCAYAAAGATATYGGCAC) dan HCO2198 (TAAACTTCAGGGTGACCAAAAAA TCA). Pengolahan data sekuens dilakukan dengan menggunakan program ABsequence3 dan MEGA ver 6.  Pencocokan karakter nukleotida gen COI dilakukan dengan menggunakan program nBLAST yang terintegrasi pada laman GenBank. Sampel sirip yang berhasil dikoleksi berasal dari 4 individu yang berbeda.  Hasil nBLAST menunjukkan bahwa keempat sampel sirip hiu tersebut teridentifikasi sebagai spesies Triaenodon obesus.  Nilai keakuratan pensejajaran sekuens, nilai dugaan, prosentase panjang nukleotida yang selaras, dan prosentase tingkat kemiripan, masing-masing pada nilai antara 604-1245, 0.0, 70-99% dan 92-99%.

ISRN Zoology ◽  
2012 ◽  
Vol 2012 ◽  
pp. 1-8 ◽  
Author(s):  
Hiroko Somura ◽  
Hiroshi Hori ◽  
Yoshinobu Manome

The slow loris (Nycticebus) is a prosimian that is popular among exotic pet lovers. In Japan, many slow lorises have been imported illegally. Prosimians that have been confiscated in raids are protected in Japanese zoos, and the number of such animals has increased. In most cases, the country of origin remains unknown and even the species can be difficult to identify from the animal’s physical appearance alone. We have attempted to resolve this problem by using DNA analysis. DNA samples of five species, consisting of the Pygmy slow loris (Nycticebus pygmaeus), Bengal slow loris (Nycticebus bengalensis), Sunda slow loris (Nycticebus coucang), Javan slow loris (Nycticebus javanicus), and Bornean slow loris (Nycticebus menagensis), were extracted, amplified, and the nucleotide sequences of mitochondrial 12S rRNA, 16S rRNA, and the cytochrome oxidase subunit 1(COI) regions were compared. Differences of nucleic acid sequences of representative individuals were demonstrated.


Author(s):  
Yangrae Rho ◽  
◽  
Hoyeon Lee ◽  
Hiyoung Kim ◽  
Inho Yang ◽  
...  

The current study reports the cytochrome oxidase subunit 1 sequence of Gastropoda Ergalatax contracta from Busan, Korea. Four specimens were collected and extracted to obtain genomic DNA for the sequencing analysis. This is the first E. contracta sequence from Korea submitted to the NCBI for an accession number.


Sign in / Sign up

Export Citation Format

Share Document