Relationship between the biomass of reef shark and fish in South Morotai Waters, North Maluku, Indonesia

Sofyan JF, Ambariyanto A, Suwartimah K, Toha AHA. 2020. Relationship between the biomass of reef shark and fish in South Morotai Waters, North Maluku, Indonesia. Biodiversitas 21: 5605-5613. This study aims to determine the biomass of reef shark and fish in South Morotai Waters in North Maluku, Indonesia. The Audible Stationary Count and Underwater Visual Census method were used to collect the data of reef sharks and fish. Seven and one site locations of coral reef and shark ecosystems were surveyed and, the data were analyzed using regression analysis to obtain a correlation between the variables. The three reef sharks found were Carcharhinus melanopterus, Triaenodon obesus, and Carcharhinus amblyrhynchos. Biomass estimation of reef sharks and fish ranged from 0.59 to 19.97 kg/ha and 30.95 kg/ha to 49.92 kg/ha, consisting of 8 families. In the area of aggregations, both species were found in 7 sites, and the population of reef shark amounted to 86.96 kg/ha and fish was around 55.705 kg/ha, consisting of 9 families. There was a positive relationship between the biomass of reef shark and fish in South Morotai waters, and the index of determination was 0.8043, showing that the biomass of reef shark was influenced by that of fish. These results indicated the importance of biomass in determining the functional composition and diversity of reef shark and fish.

Residencia del tiburón punta blanca de arrecife, Triaenodon obesus, (Carcharhiniformes: Carcharhinidae) en las bahías Chatham y Wafer del Parque Nacional Isla del Coco, Costa Rica

Introducción: El tiburón punta blanca (Triaenodon obesus) es una especie de arrecife de aguas tropicales, no migratoria, que ha demostrado no tener una alta conectividad costera, como la observada para otras especies de tiburón, sin embargo posee la distribución más amplia de todas las demás especies de tiburón de arrecife del Indo-Pacífico. T. obesus, es una de las especies de tiburón más comunes en el Parque Nacional Isla del Coco (PNIC), y no presenta una estacionalidad marcada. En las bahías localizadas en el norte del PNIC, Bahía Chatham y Bahía Wafer, reside una saludable población del tiburón punta blanca de arrecife. A pesar de ser una especie abundante en las bahías Chatham y Wafer del PNIC, la información sobre su residencia resulta escaza. Objetivo: Conocer sobre el uso de hábitat y los movimientos del tiburón punta blanca de arrecife mejorará su manejo en el PNIC y en otros lugares del Pacífico Tropical Oriental. Para esto se realizó un estudio preliminar sobre la residencia en las bahías Chatham y Wafer del PNIC, utilizando telemetría acústica. Métodos: Se realizó una expedición de marcaje de tiburones al Parque Nacional Isla del Coco entre el 25 de noviembre al 5 de diciembre del 2014. Durante esta expedición se realizaron 2 giras nocturnas entre las 18:00 y las 22:00 a Bahía Chatham y Bahía Wafer y se marcaron 8 individuos de T. obesus con telemetría acústica y se instalaron dos receptores, uno en cada bahía. Resultados: Entre noviembre 2014 y diciembre 2015 los tiburones punta blanca marcados fueron detectados por los receptores instalados en las bahías en un total de 278 706 ocasiones. Los tiburones T. obesus marcados permanecieron largos periodos en las bahías Chatham y Wafer, El índice de Residencia (IR) medio de los T. obesus marcados fue de 0.97±0,03, reportando una tendencia en la baja del número total de detecciones durante las horas nocturnas. Los tiburones punta blanca de arrecife mostraron una alta fidelidad al sitio de marcaje, que se ve reflejado en los elevados índices de residencia reportados, particularmente altos en comparación con otras especies de tiburón de arrecife. Las detecciones de los tiburones en las bahías tienden a disminuir a partir de las 18:00 horas, cuando el tiburón punta blanca se vuelve activo para cazar en el arrecife. Conclusiones: En conclusión, los tiburones punta blanca poseen una alta residencia y fidelidad, lo cual confirma su bajo rango de hogar. El Área Marina Protegida de la Isla del Coco probablemente brinda una protección efectiva a la población del tiburón punta blanca de la pesca ilegal.

How to Kill Another Shark: A First Inside Look at a Potential Hunting Strategy of the Galapagos Shark

Background: Close-up videos of sharks foraging on other live sharks are rare, especially when it comes to footage of the entire duration of an event. Objective: Our goal was to present an in-depth analysis involving a Galapagos shark, Carcharhinus galapagensis, foraging on a whitetip reef shark, Triaenodon obesus. Method: A frame by frame video examination was used to highlight the different aspects of this bout. Results: Several behavioral characteristics, including the somewhat cryptic approach, the extensive shaking once the Galapagos shark had the whitetip reef shark between its jaws, and devouring tail-first, stand out in this event. Conclusion: The entire act appeared very smooth, indicating that this bout, or at least parts thereof, may represent a common hunting strategy for Galapagos sharks.

Alur Perdagangan Hiu sebagai Komoditas Ikan Hias dari Provinsi Bali

This study objectives were to investigate the track of shark trade from Bali Province, the exports volume of shark trade during 2015-2016, the length of sharks; species exported in the ETP category; and the effectiveness of shark trade license by BPSPL Denpasar based on EAFM analysis. This study used exploration method with questionnaires, interviews and secondary data from BPSPL Denpasar. The results showed that the track of shark trade started from when the shark is caught by the fishermen which purchased by exporter companies, then they had to get shipment recommendation letter from BPSPL Denpasar and fish health certificate from BKIPM Class I Denpasar, then sharks was brought to I Gusti Ngurah Rai International Airport for final check and ready to be exported to the destination country. During 2015-2016 there were 559 sharks from the species of Carcharhinus melanopterus, Triaenodon obesus, Orectolobus maculatus, Atelomycterus marmoratus, Chiloscyllium plagiosum and Halaelurus maculosus that have been exported to the 12 destination countries. The EAFM analysis of lengths indicated that the shark's size was at a very young until adult age. Meanwhile, the EAFM analysis of ETP species shows there were 4 shark types of Near Threatened, 1 type of Least Concern status and 1 type of Not Evaluated. Finally the result of EAFM analysis on the effectiveness of shark trade license by BPSPL Denpasar showed that the decision was well executed and run effectively, and so far the shark fishery management at Bali Province is applied successfully.

Abundancia, tamaño y estructura poblacional del tiburón punta blanca de arrecife, Triaenodon obesus (Carcharhiniformes: Carcharhinidae), en Bahía Chatham, Parque Nacional Isla del Coco, Costa Rica

Abundance, size and population structure of whitetip reef sharks, Triaenodon obesus (Carcharhiniformes: Carcharhinidae), in Bahía Chatham, Parque Nacional Isla del Coco, Costa Rica. Approximately 12 species of shark inhabit at Coco Island National Park (PNIC); some are migratory, such as the hammerhead shark (Sphyrna lewini) and whale shark (Rincodon typus), and others are resident, like the whitetip shark (Triaenodon obesus). The whitetip shark is a species related to coral reefs, it inhabits coastal environments and is nocturnal and, it is very common in tropical waters, but there are few studies worldwide. In fact, only short researches have been done about their behavior at PNIC. Therefore, this study aimed to give data about the abundance, size and population structure of the whitetip shark at Chatham Bay in Coco Island National Park, providing baseline information for monitoring its population which is also very vulnerable to climate change. In order to accomplish this aim, a mark-recapture method was used, as well as underwater visual counts to determine their relative abundance and visual recaptures at Chatham Bay. The most effective hours for tagging were between 18:00 and 22:00 (sunset), when the whitetip sharks were more active probably related to foraging behavior. In addition, the depth was a relevant factor for tagging, sharks were caught in shallow water (10.9±1.9m). This species prefers to feed in shallow water and this behavior is probably related to the distribution and occurrence of rock and coral reefs in Chatham Bay. Based on the results, whitetip shark do not have a defined spatial ontogenic segregation, since in the same sites both juveniles and adults were found. The study confirmed that whitetip shark use specific residence sites: during the tagging trips, different individuals were recaptured; and during the underwater counts, at least 32.76% of tagged sharks were observed. The average length of the tagged sharks was 101.8±12.1cm (130.0cm maximum and 71.0cm minimum). The relative abundance of the whitetip shark in Chatham Bay observed was estimated on 49.5±10.4 sharks/hour. Furthermore, using the recapture data obtained during the night tagging expeditions, a population of 408 (IC = 181-1050) sharks was estimated. Citation: Zanella, I., A. López-Garro, G. Golfín-Duarte & J.C. Sáenz. 2012. Biología del tiburón punta blanca de arrecife, Triaenodon obesus (Carcharhiniformes: Carcharhinidae), en Bahía Chatham, Parque Nacional Isla del Coco, Costa Rica. Rev. Biol. Trop. 60 (Suppl. 3): 339-346. Epub 2012 Dec 01.

Identifikasi sirip ikan hiu yang didapat dari pengumpul di Minahasa Tenggara menggunakan DNA Barcode

Populasi ikan hiu global menunjukkan penurunan yang signifikan karena; penangkapan yang masif dan tak terkontrol, karakter biologi reproduksi yang lambat serta fekunditas yang rendah. Indonesia merupakan salah satu negara kontributor terbesar dalam perdagangan sirip ikan hiu dunia. Tingginya aktifitas perdagangan sirip tersebut berpengaruh terhadap populasi ikan hiu dan berdampak pada turunnya kualitas keseimbangan ekosistem laut. Tujuan penelitian ini untuk mengidentifikasi ikan hiu dari potongan sirip yang didapat dari pengumpul di Tumbak, Minahasa Tenggara menggunakan DNA barcode. Ekstraksi DNA genom sirip hiu kering dilakukan dengan menggunakan prosedur DNeasy Blood & Tissue kit, amplifikasi gen Cytochrome Oxidase Subunit 1 (COI) dilakukan dengan menggunakan primer Fish BCL5 (TCAACYAATCAYAAAGATATYGGCAC) dan HCO2198 (TAAACTTCAGGGTGACCAAAAAA TCA). Pengolahan data sekuens dilakukan dengan menggunakan program ABsequence3 dan MEGA ver 6. Pencocokan karakter nukleotida gen COI dilakukan dengan menggunakan program nBLAST yang terintegrasi pada laman GenBank. Sampel sirip yang berhasil dikoleksi berasal dari 4 individu yang berbeda. Hasil nBLAST menunjukkan bahwa keempat sampel sirip hiu tersebut teridentifikasi sebagai spesies Triaenodon obesus. Nilai keakuratan pensejajaran sekuens, nilai dugaan, prosentase panjang nukleotida yang selaras, dan prosentase tingkat kemiripan, masing-masing pada nilai antara 604-1245, 0.0, 70-99% dan 92-99%.