Case Report: An Eyelid Nodule Caused by Candidatus Dirofilaria hongkongensis Diagnosed by Mitochondrial 12S rRNA Sequence

ABSTRACT. A 59-year-old female living in Rayong Province, eastern Thailand, presented with painless, right upper eyelid nodule for 3 months. Upon removal of the eyelid mass, a well-circumscribed, firm globular mass with diameter about 1 cm was found. Histopathological examination revealed an immature female dirofilarial worm reminiscent of Dirofilaria repens, characterized by prominent sharp longitudinal ridges at external surface of the cuticle. Analysis of the mitochondrial 12S rRNA sequence showed that the worm belongs to Candidatus Dirofilaria hongkongensis. It is likely that some infections previously reported as D. repens based on histological examination may have actually been due to Candidatus D. hongkongensis.

Application of Environmental DNA (eDNA) Metabarcoding Method to Identify Threatened Sulawesi Mammal Based on 12S rRNA Gene

Species detection and identification is a crucial steps in biodiversity assessment. Traditional methods are often invasive and resource intensive. The number of studies demonstrating successful of eDNA metabarcoding approach in species identification has increased rapidly in recent years. Some of large terrestrial mammals have reportedly utilize natural salt licks as a source of minerals in the diet and its genetic material left in the environment can be used to identify species from this site. An eDNA metabarcoding protocol had been carried out to identify Sulawesi mammals from Adudu natural salt-licks, Nantu Wildlife Reserve, Gorontalo. Environmental DNA were extracted from water samples, Amplicon libraries were prepared by PCR amplification and Illumina MiSeq high throughput sequencing. Reads processing and taxonomic assignment carried out in two bioinformatics packages, PipeCraft-1.0 and OBITools-2.11. Two endangered Sulawesi mammals species had been identified, i.e. lowland anoa (Bubalus depressicornis) and babirusa (Babyrousa babyrussa). The accuracy of mammal species identification using eDNA metabarcoding is affected by rigorous experimental procedures, DNA marker reliability, and availability of reference sequence database.

Towards environmental detection of Chagas disease vectors and pathogen

Background: Accurate surveillance of triatomine household infestation is crucial for Chagas disease vector control. However, no gold standard detection method with high levels of sensitivity or specificity is currently available. Several intrinsic features of triatomine bug behaviour and the lifecycle of Trypanosoma (T.) cruzi lead to deposition of environmental DNA (eDNA) in infested houses. This study evaluated the use of FTA cards and cotton-tipped swabs as low-technology, cost-effective tools for simultaneous detection of T. cruzi and vector eDNA in the laboratory and field. Methods/Principal Findings: This study had two components: (1) laboratory evaluation and optimisation of QIAcard® FTA® classic cards to detect Rhodnius (R.) prolixus eDNA by altering five different environmental variables (darkness, triatomine number, temperature, feeding status and degradation at ambient temperature); (2) detection of R. prolixus and T. cruzi eDNA from cotton-tipped house wall swabs from an endemic region in Casanare Department, Colombia. eDNA was extracted from all specimens and amplified using a multiplex TaqMan qPCR assay targeting the R. prolixus 12S rRNA gene and T. cruzi satellite DNA region. R. prolixus eDNA from five 3rd/4th instar nymphs was successfully amplified from FTA cards after as little as 15 minutes of contact time under standard insectary conditions. Factors significantly increasing eDNA detection from FTA cards were increasing temperature from 21oC to 27-32oC, triatomine bug density from 1-25 bugs and recent blood-feeding. eDNA was detectable from FTA cards stored at room temperature for at least two weeks. In cotton-tipped swabs from the field, the sensitivity and specificity of R. prolixus eDNA detection was 60.6% (n=20/33) and 100% (n=33/33), respectively. T. cruzi eDNA was amplified from 93.9% (n=31/33) of infested houses. Conclusions/Significance: FTA cards are a highly sensitive tool for entomological surveillance of R. prolixus and exhibit little variability under different environmental conditions. Additionally, cotton-tipped swabs are a relatively sensitive tool for entomological and parasitological surveillance of R. prolixus and T. cruzi in situ, but more feasible due to low cost. Both methods could be utilised by citizen science initiatives to contribute to the control of Chagas disease in endemic communities.

Molecular phylogeny of Lytorhynchus diadema (Reptilia, Colubridae) populations in Saudi Arabia

This study presents the molecular phylogenetic relationships among Lytorhynchus diadema (Duméril, Bibron & Duméril, 1854) populations in Saudi Arabia relative to populations from Africa and Asia. This phylogenetic analysis was based on mitochondrial 16S and 12S rRNA partial gene fragments using Neighbor-joining, Maximum Parsimony, and Bayesian methods. The results strongly support the monophyly of Lytorhynchus based on two concatenated genes and the 12S rRNA gene separately. Also, a significant separation is observed between the Arabian samples from Saudi Arabia, Yemen, and Oman, and the African populations from Egypt, Tunisia, and Morocco.

Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.

Molecular survey of cattle ticks in Burundi: First report on the presence of the invasive Rhipicephalus microplus tick

A recent research study on prevalence of tick-borne pathogens in Burundi reported high prevalence and endemicity of Theileria parva, Anaplasma marginale and Babesia bigemina infections in cattle. Detailed information about tick species infesting animals, their distribution and genetic diversity in Burundi is outdated and limited. This study therefore assessed the prevalence and genetic diversity of tick species infesting cattle across agroecological zones (AEZs) in Burundi. A cross-sectional study on the occurrence of tick species was conducted in 24 districts of Burundi between October and December 2017. Differential identification and characterization of ticks collected was conducted using tick morphological keys and molecular tools (cox1 and 12S rRNA gene). Chi-square test was used to test for association between agroecological zones and the prevalence of tick species. Phylogenetic relationships were inferred using bayesian and maximum likelihood algorithms. A total of 483 ticks were collected from the five AEZs sampled. Six tick species comprising of Rhipicephalus appendiculatus, R. sanguineus, R. evertsi evertsi, R. microplus, R. decoloratus and Amblyomma variegatum were observed. Rhipicephalus appendiculatus were the most prevalent ticks (~45%). A total of 138 specimens (28%) were found to be Rhipicephalus microplus, suggesting an emerging threat for cattle farmers. Twelve R. appendiculatus cox1 haplotypes were obtained from 106 specimens that were sequenced. Two cox1 haplotypes of R. microplus which clustered into previously reported Clade A were observed. Rhipicephalus sanguineus and R. evertsi evertsi ticks, the vectors of numerous zoonotic pathogens, were collected from cattle, which constitute a high risk for public health. These findings reveal an overlapping distribution of tick vectors in Burundi. The design of ticks and tick-borne diseases control strategies should consider the distribution of different vectors across the AEZs particularly the presence of the highly invasive R. microplus tick in Burundi and the potential risk of introducing the pathogenic Babesia bovis.

Mitogenomics and the Phylogeny of Mantis Shrimps (Crustacea: Stomatopoda)

Stomatopoda, commonly known as mantis shrimps, are notable for their enlarged second maxillipeds encompassing the raptorial claw. The form of the claw can be used to divide them into two basic groups: smashers and spearers. Previous phylogenetic studies of Stomatopoda have focused on morphology or a few genes, though there have been whole mitochondrial genomes published for 15 members of Stomatopoda. However, the sampling has been somewhat limited with key taxa not included. Here, nine additional stomatopod mitochondrial genomes were generated and combined with the other available mitogenomes for a phylogenetic analysis. We used the 13 protein coding genes, as well as 12S rRNA, 16S rRNA genes, and included nuclear 18S rRNA gene sequences. Different rooting options were used for the analyses: (1) single and multiple outgroups from various eumalocostracan relatives and (2) a stomatopod-only dataset, with Hemisquilla californiensis used to root the topologies, based on the current hypothesis that Hemisquilla is the sister group to the rest of Stomatopoda. The eumalocostracan-rooted analyses all showed H. californiensis nested within Stomatopoda, raising doubts as to previous hypotheses as to its placement. Allowing for the rooting difference, the H. californiensis outgroup datasets had the same tree topology as the eumalocostracan outgroup datasets with slight variation at poorly supported nodes. Of the major taxonomic groupings sampled to date, Squilloidea was generally found to be monophyletic while Gonodactyloidea was not. The position of H. californiensis was found inside its superfamily, Gonodactyloidea, and grouped in a weakly supported clade containing Odontodactylus havanensis and Lysiosquillina maculata for the eumalocostracan-rooted datasets. An ancestral state reconstruction was performed on the raptorial claw form and provides support that spearing is the ancestral state for extant Stomatopoda, with smashing evolving subsequently one or more times.

Three critical regions of the erythromycin resistance methyltransferase, ErmE, are required for function supporting a model for the interaction of Erm family enzymes with substrate rRNA

6-methyladenosine modification of DNA and RNA is widespread throughout the three domains of life and often accomplished by a Rossmann-fold methyltransferase domain which contains conserved sequence elements directing S-adenosylmethionine cofactor binding and placement of the target adenosine residue into the active site. Elaborations to the conserved Rossman-fold and appended domains direct methylation to diverse DNA and RNA sequences and structures. Recently the first atomic resolution structure of a Ribosomal RNA Adenine Dimethylase (RRAD) family member bound to rRNA was solved, TFB1M bound to helix 45 of 12S rRNA. Since erythromycin resistance methyltransferases are also members of the RRAD family and understanding how these enzymes recognize rRNA could be used to combat their role in antibiotic resistance, we constructed a model of ErmE bound to a 23S rRNA fragment based on the TFB1M-rRNA structure. We designed site-directed mutants of ErmE based on this model and assayed the mutants by in vivo phenotypic assays and in vitro assays with purified protein. Our results and additional bioinformatic analyses suggest our structural model captures key ErmE-rRNA interactions and suggest three regions of Erm proteins play a critical role in methylation: the target adenosine binding pocket, the basic ridge and the α4-cleft.

Development of novel PCR primer sets for DNA metabarcoding of aquatic insects, and the discovery of some cryptic species

DNA barcoding is a powerful tool that provides rapid, accurate, and automatable species identification by using standardized genetic region(s). It can be a powerful tool in various fields of biology such as for revealing the existence of cryptic species and/or rare species and in environmental science such as when monitoring river biota. Biodiversity reduction in recent times has become one of the most serious environmental issues on a worldwide scale. DNA barcoding techniques require the development of sets of universal PCR primers for DNA metabarcoding. We tried to develop universal primer sets for the DNA barcoding of all insect groups. In this study, we succeeded in designing not only universal primer sets for DNA barcoding regions of almost all insects, which were designed to include a hypervariable site between highly conserved sites, but also primer sets for longer fragment sequences for registration in a database. We confirmed successful amplification for 14 orders, 43 families, and 68 species with DNA barcoding in the mtDNA 16S rRNA region, and for 13 orders, 42 families, and 66 species with DNA barcoding in the mtDNA 12S rRNA region. A key feature is that the DNA fragments of the DNA barcoding regions amplified by these primer sets are both short at about 200-bp, and longer fragment sequences will increase the level of data registration in the DNA database. Such resulting database enhancements will serve as a powerful tool for increasingly accurate assessment of biodiversity and genetic diversity.

Molecular species delimitation of shrub frogs of the genus Pseudophilautus (Anura, Rhacophoridae)

Sri Lanka is an amphibian hotspot of global significance. Its anuran fauna is dominated by the shrub frogs of the genus Pseudophilautus. Except for one small clade of four species in Peninsular India, these cool-wet adapted frogs, numbering some 59 extant species, are distributed mainly across the montane and lowland rain forests of the island. With species described primarily by morphological means, the diversification has never yet been subjected to a molecular species delimitation analysis, a procedure now routinely applied in taxonomy. Here we test the species boundaries of Pseudophilautus in the context of the phylogenetic species concept (PSC). We use all the putative species for which credible molecular data are available (nDNA–Rag-1; mt-DNA– 12S rRNA, 16S rRNA) to build a well resolved phylogeny, which is subjected to species delimitation analyses. The ABGD, bPTP, mPTP and bGMYC species delimitation methods applied to the 16S rRNA frog barcoding gene (for all species), 12S rRNA and Rag-1 nDNA grouped P. procax and P. abundus; P. hallidayi and P. fergusonianus; P. reticulatus and P. pappilosus; P. pleurotaenia and P. hoipolloi; P. hoffmani and P. asankai; P. silvaticus and P. limbus; P. dilmah and P. hankeni; P. fulvus and P. silus.. Surprisingly, all analyses recovered 14 unidentified potential new species as well. The geophylogeny affirms a distribution across the island’s aseasonal ‘wet zone’ and its three principal hill ranges, suggestive of allopatric speciation playing a dominant role, especially between mountain masses. Among the species that are merged by the delimitation analyses, a pattern leading towards a model of parapatric speciation emerges–ongoing speciation in the presence of gene flow. This delimitation analysis reinforces the species hypotheses, paving the way to a reasonable understanding of Sri Lankan Pseudophilautus, enabling both deeper analyses and conservation efforts of this remarkable diversification. http://zoobank.org/urn:lsid:zoobank.org:pub:DA869B6B-870A-4ED3-BF5D-5AA3F69DDD27.